Abstract
Objective:
Skeletal muscle produces a variety of secreted proteins that have important roles in intercellular communication and affects processes such as glucose homoeostasis. The objective of this study was to develop a novel Signal Sequence Trap (SST) in conjunction with cDNA microarray technology to identify proteins secreted from skeletal muscle of Psammomys obesus that were associated with obesity and type 2 diabetes (T2D).
Design:
Secreted proteins that were differentially expressed between lean, normal glucose tolerant (NGT), overweight and impaired glucose tolerant (IGT) and obese, T2D P. obesus were isolated using SST in conjunction with cDNA microarray technology. Subsequent gene expression was measured in tissues from P. obesus by real-time PCR (RT-PCR).
Results:
The SST yielded 1600 positive clones, which were screened for differential expression. A total of 91 (∼6%) clones were identified by microarray to be differentially expressed between NGT, IGT and T2D P. obesus. These clones were sequenced to identify 51 genes, of which only 27 were previously known to encode secreted proteins. Three candidate genes not previously associated with obesity or type 2 diabetes, sushi domain containing 2, collagen and calcium-binding EGF domains 1 and periostin (Postn), as well as one gene known to be associated, complement component 1, were shown by RT-PCR to be differentially expressed in skeletal muscle of P. obesus. Further characterization of the secreted protein Postn revealed it to be predominantly expressed in adipose tissue, with higher expression in visceral compared with subcutaneous adipose depots.
Conclusion:
SST in conjunction with cDNA microarray technology is a powerful tool to identify differentially expressed secreted proteins involved in complex diseases such as obesity and type 2 diabetes. Furthermore, a number of candidate genes were identified, in particular, Postn, which may have a role in the development of obesity and type 2 diabetes.
Similar content being viewed by others
Introduction
The homoeostasis of blood glucose levels is a precisely coordinated process1 and involves a tightly regulated balance between food intake, glucose production by the liver and glucose utilization by insulin-dependent tissues (mainly skeletal muscle and adipose tissue) and insulin-independent tissues (such as brain and kidney).2 Glucose homoeostasis is regulated by secreted proteins and hormones that act on a range of tissues to influence glucose disposal or production and long-term energy balance. For example, leptin (from adipose tissue) and insulin (from the pancreas) are both long-term adiposity regulators.3 Glucagon is also secreted from the pancreas, and is important in regulating glucose metabolism, particularly in the liver.4 Dysregulation of a range of secreted proteins has been associated with obesity, insulin resistance and type 2 diabetes.
Skeletal muscle comprises almost 40% of total body weight and is responsible for approximately 80% of insulin-dependent glucose disposal during glucose and insulin infusion.5 It has been suggested that skeletal muscle, like adipose tissue, produces secretory factors termed myokines that act in an autocrine, paracrine or endocrine fashion.6, 7, 8 Examples of muscle-derived secreted proteins include myostatin, transforming growth factor-β and IL-4; however, these proteins are involved in skeletal muscle growth and differentiation.9, 10, 11 Only a limited number of muscle-derived secreted proteins or hormones involved in regulating energy metabolism have been identified. Recent research has demonstrated that cytokines, such as IL-15 and IL-6, which are secreted by muscle may have a role in glucose metabolism in skeletal muscle in vitro and in vivo.12, 13, 14, 15, 16, 17 In addition, Nishizawa et al (2004) identified a novel skeletal muscle-derived secretory factor, musclin, whose expression was tightly regulated by nutritional changes as well as being regulated by insulin.6
The aim of this study was to identify secreted proteins that were differentially expressed in skeletal muscle during the development of obesity and type 2 diabetes. Red gastrocnemius muscle was selected because it has been extensively studied in relation to insulin resistance and type 2 diabetes (T2D), providing a wealth of background information to facilitate interpretation of results. As a model system we have used Psammomys obesus, a unique polygenic model of obesity, insulin resistance and type 2 diabetes,18, 19, 20 which display a range of phenotypic characteristics such as obesity and insulin resistance when given free access to a standard laboratory diet.20 The P. obesus genome is incompletely characterized, which precluded utilizing a bioinformatics approach to identify muscle-derived secreted proteins associated with obesity and type 2 diabetes in this model system. Therefore, a functional bioassay, the Signal Sequence Trap (SST), was developed to identify proteins secreted from red gastrocnemius muscle that were differentially expressed between lean, normal glucose tolerant (NGT), overweight and insulin resistant (IGT) and obese T2D P. obesus.
Materials and methods
Experimental animals
A colony of P. obesus was maintained at Deakin University, Geelong, Australia. Animals were fed ad libitum a standard rodent diet from which 63% of energy was derived from carbohydrate, 25% from protein and 12% from fat (Barastoc, Pakenham, Australia). Animals were maintained in a temperature-controlled room (22±1 °C) with a 12–12 h light–dark cycle (0600–1800 light). At 16 weeks of age, animals were classified into three groups according to their blood glucose and plasma insulin concentrations as previously described.18 The three groups were classified as follows: lean, NGT, overweight and IGT and obese, T2D. Whole blood glucose was measured using an enzymatic glucose analyzer (Model 27, Yellow Springs Instruments, Yellow Springs, OH, USA) and plasma insulin concentrations were determined using a double antibody solid phase radioimmunoassay (Linco, Billerica, MA, USA).
At 18 weeks of age, male P. obesus in each of the three groups were separated into two treatment groups, either ‘fed’ in which animals had ad libitum access to chow or ‘fasted’ in which animals were fasted for 24 h. The phenotypic characteristics of the animals are previously described.21 Animals were killed by anaesthetic overdose (pentobarbitone, 120 mg/kg, Sigma, St Louis, MO, USA) and the red gastrocnemius tissue for SST library construction was rapidly excised and placed in TRIzol (Invitrogen, Carlsbad, CA, USA) for immediate RNA extraction and further purification using RNeasy Midi Columns (Qiagen, Hilden, Germany).
All experiments were conducted according to National Health and Medical Research Council guidelines, and were approved by the Deakin University Animal Welfare Committee.
Cell culture
X63 cells22 and Factor-Dependent Cell Progenitor 1 cells (FDCP1)23 were a kind gift from Dr David Huang, Walter & Elisa Hall Institute of Medical Research, Melbourne, Australia. X63 cells were engineered to secrete high levels of IL-3, and the supernatant from these cells was used as a source of IL-3 for growth of IL-3-dependent FDCP1 cells. X63 cells were maintained in high glucose (25 mM) DMEM (Gibco, Invitrogen) supplemented with 10% FBS (Gibco), 50 μM β-mercaptoethanol (Sigma) and 100 μM L-asparagine (Sigma) at 37 °C in 5% CO2. The supernatant was collected and filtered through a 0.2 μM membrane (Pall Life Sciences, Ann Arbor, MI, USA), aliquoted and stored −20 °C. FDCP1 cells were maintained in high glucose (25 mM) DMEM supplemented with 10% FBS, 50 μM β-mercaptoethanol, 100 μM L-asparagine and 4% X63 cell supernatant, at 37 °C in 5% CO2. Plat-E24 cells were maintained in high glucose (25 mM) DMEM supplemented with 10% FBS, 10 μg ml−1 blasticidin (Sigma), 1 μg ml−1 puromycin (Invitrogen), 50 U ml−1 penicillin (Invitrogen) and 50 μg ml−1 streptomycin (Invitrogen), at 37 °C in 10% CO2.
Construction of murine IL-3 reporter gene construct for SST
RNA was extracted from X63 cells using RNeasy Mini Columns (Qiagen) and reverse transcribed. The cDNA was used as a template to PCR amplify full-length murine IL-3 (mIL-3) with primers (forward 5′ CCTTGGAGGACCAGAACGAGACAAT 3′ and reverse 5′ GCACTGCCTGCTGTTTTAACATTC 3′). The full-length mIL-3 construct was sequence verified and determined to be in frame.
The PCR product was subsequently used as a template to amplify the pro mIL-3 sequence lacking its signal peptide (amino acids 26–166, NP_034686). Primers were designed to contain NotI and XhoI restriction sites (underlined, forward 5′ TGACACGCCTGCGGCCGCAAGCTTCAATCAGTGGCCGGGATA 3′, and reverse 5′ ACGCCTCTCGAGTTAACATTCCACGGTTCCACGGTTA 3′). PCR products were purified and sequenced.
Construction of retrovirus expression vector containing mIL-3 reporter construct for SST
The purified pro mIL-3 DNA was digested with NotI and XhoI (New England Biolabs, Ipswich, MA, USA), treated with calf intestinal phosphatase (New England Biolabs) and ligated into pLNCX2 (Clonetech, Mountain View, CA, USA) vector DNA previously digested with NotI and SalI. The ligated products were transformed into ElectroMAX DH10β cells (Invitrogen) by electroporation. Recombinant clones were identified by a colony PCR using pLNCX2 vector-specific primers (forward 5′ AGCTCGTTTAGTGAACCGTCAGATC 3′ and reverse 5′ AGCTAGCTTGCCAAACCTACAG 3′). Large-scale preparation of plasmid DNA was performed on sequence verified positive clones using an Endofree Plasmid Maxi kit (Qiagen). The resulting vector was termed pLNCX2PRO.
Construction of cDNA library, cloning and amplification for SST
The SST methodology is illustrated in Figure 1. Total RNA was extracted from the red gastrocnemius muscle of fed and fasted NGT, IGT and T2D P. obesus. RNA from each group was pooled and polyA mRNA twice purified using the FastTrack 2.0 kit (Invitrogen). cDNA was synthesized from polyA mRNA using a modified Superscript Plasmid System with Gateway Technology for cDNA Synthesis and Cloning kit (Invitrogen), with random nonamers designed to contain a 5′NotI restriction site (underlined) (5′pTCTAGATCGCGAGCGGCCGCCCN9 3′). After second strand synthesis, SalI adaptor addition and NotI digestion, the 300–800 bp products were excised from an agarose gel and purified. The cDNA was subsequently inserted into NotI, XhoI sites of pLNCX2PRO and the ligated DNA electroporated into Electromax DH10β cells (Gibco). Plasmid DNA was purified using an Endofree Plasmid Maxi kit (Qiagen).
Transfection of Plat-E cells
Plat-E cells were transfected with 14 μg plasmid DNA using Lipofectamine Plus (Invitrogen). Cells were incubated for 48 h and the supernatant was subsequently collected and processed for retrovirus infection of FDCP1 cells.
SPINfection of FDCP1 cells
Retrovirus supernatant from Plat-E cells transfected with skeletal muscle library plasmid was filtered using a 0.45 μM. polysulphonic filter (Pall Lifesciences) and 8 μg ml−1 polybrene (Sigma) and 4% X63 cell supernatant were added. FDCP1 cells (6 × 106) were resuspended in this solution and plated out. The plate was centrifuged at 1000 g for 1 h then the cells were incubated at 37 °C for 4 h. FDCP1 cells were subsequently collected, washed once and resuspended in FDCP1 maintenance media containing 4% X63 cell supernatant. The cells were plated out and incubated overnight before being washed three times and resuspended in FDCP1 maintenance media lacking X63 supernatant. Cells were plated at 103 cells per well in a 96-well round bottom plate and grown for 3 days.
Positive-clone selection and gDNA extraction
Cell media was refreshed with FDCP1 maintenance media (lacking IL-3) every 3 days and cells grown for 5 weeks. Genomic DNA was extracted from clones in wells containing a minimum of 10 000 cells.
PCR amplification of insert and sequence verification
A nested PCR protocol was utilized to amplify cDNA using the genomic DNA template and primary pLNCX2 primers (forward 5′ CTGGTTTAGTGAACCGTCAGATC 3′ and reverse 5′ CTCCTTGACAATAGAGCTGCAA 3′) and secondary primers (forward 5′ TAGCGCTACCGGACTCAGAT 3′ and reverse 5′ CGGCCACTGATTGAAGCTT 3′). A subset of 163 clones were randomly selected for sequencing.
cDNA microarray analysis of gene expression
PCR products were purified using an ArrayIt PCR Purification kit (TeleChem International, Sunnyvale, CA, USA). Samples were resuspended in 1 × Spotting Solution Plus (ArrayIt, TeleChem International) and printed onto SuperAmine microarray glass slides (TeleChem International) with ArrayIt Stealth SMP3 quill-tipped microarray pins (TeleChem International) using a CWP robotic arrayer (Biorad Laboratories, Hercules, CA, USA) at 50–60% humidity. Slides were subsequently stored at 35% humidity to dry for 24 h before being washed and blocked as per the manufacturer's instructions.
A pool of RNA from red gastrocnemius muscle of P. obesus groups (NGT, IGT and T2D in fed state) was reverse transcribed and labelled with the fluorescent dye Cy3 (Amersham Pharmacia Biotech, Little Chalfont, UK) and used as the reference. RNA from individual animals was labelled with Cy5. Hybridization was performed with combined target and reference fluorescently labelled cDNAs on slides in hybridization chambers at 42 °C for 16 h. Slides were scanned using a GenePix 4000B scanner (Axon Instruments, Sunnyvale, CA, USA) and microarray data analyzed using GenePix Pro 5.1 and Acuity 4.0 software (Axon Instruments). Linear normalization was performed on each array using only features that passed the quality control filtering criteria. The filtering criteria defined an acceptable expression value as one that was two s.d. above the background noise, was not derived from a saturated signal and its total fluorescent intensity was greater than 200 U. Standard t-tests were used to identify differential expression between NGT, IGT and T2D P. obesus red gastrocnemius muscle on the microarrays. Gene expression was considered significantly different at a nominal P<0.05 level.
Sequencing of differentially expressed clones and preliminary bioinformatics
Clones identified as being differentially expressed were reamplified by PCR using the primary PCR product, sequenced and analyzed using BLAST (http://www.ncbi.nlm.nih.gov/blast), SignalP (http://www.cbs.dtu.dk/services/SignalP), SecretomeP (www.cbs.dtu.dk/services/SecretomeP-1.0/), TMHMM (http://www.cbs.dtu.dk/services/TMHMM) and Psort II (http://psort.nibb.ac.jp/).
Confirmation of differential expression by real-time PCR
For each gene of interest, forward and reverse real-time PCR (RT-PCR) primers were designed using Primer Express (Version 1.5, PE Applied Biosystems, Foster City, CA, USA). The sequences were as follows: C1r forward 5′ GCCCAACTCCGTGGAAGAG 3′ and reverse 5′ AGGAGAGCCCGTCTTTCTGAA 3′, Susd2 forward 5′ TCATAGCCCCAAAGCTCAATG 3′ and reverse 5′ TCACCTGGAACATCTCCATGC 3′, Postn forward 5′ CCCGCAGATAGCACCTTGAT 3′ and reverse 5′ GTGCCCTCCAGCAGATCCT 3′, Ccbe1 forward 5′ CTCGCCCGAAGACTTCAGAC 3′ and reverse 5′ CGCGACAGAGAAGTGTGCTC 3. A separate group of P. obesus was classified as NGT, IGT or T2D (as described above), killed, tissues were excised and RNA extracted. The concentration of RNA was determined using the RNA 6000 Nano Assay on the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). First-strand cDNA was generated using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Differential gene expression was confirmed by RT-PCR using SYBR Green PCR Master Mix (Applied Biosystems) on an ABI PRISM 7700 Sequencing Detector (Perkin Elmer, Waltham, MA, USA).
Adipose tissue fractionation
Visceral (mesenteric) adipose tissue was fractionated as previously described.21 Analysis of gene expression in each fraction was performed by RT-PCR using gene-specific primers as above. RT-PCR primers designed to leptin (Lep) and delta-like 1 homologue (Dlk1) confirmed efficient fractionation. The primer sequences were as follows: Lep forward 5′ TCGCGGTCTACCAACACATC 3′ and reverse 5′ TCTCTAGGTCGTTGGATATTTGCA 3′, Dlk1 forward 5′ GCTGCCCAACTGGATTCATC 3′ and reverse 5′ TGCTGGCACAGGCATTCA 3′.
Statistical analysis
Statistical analysis was performed using SPSS version 14.0 (SPSS Inc., Chicago, IL, USA). Levene's test for homogeneity of variance was used to determine if variance among the six animal groups (NGT fed, NGT fasted, IGT fed, IGT fasted, T2D fed, T2D fasted) was equal. One way ANOVA was used to test for differences between group means with LSD (if the variance was equal) and Games–Howell post hoc analysis (if the variance was not equal). Associations between gene expression levels and phenotypic measures were determined using Pearson's correlation for normally distributed data, or Spearman's correlation for data not normally distributed. Differences and correlations were considered significant at P<0.05.
Results
Development of SST in conjunction with microarray
To identify secreted proteins, an SST was developed in which P. obesus skeletal muscle cDNA was ligated into a retroviral expression vector upstream of a signal sequence-less IL-3. Virus containing supernatant collected from cells transfected with the vector was then used to infect IL-3-dependent FDCP1 cells. Clones which restored the ability of the signal sequence-less IL-3 to be secreted from the cells were detected by the presence of healthy, replicating FDCP1 cells. The cDNA inserts of these clones were amplified by PCR, spotted onto microarray slides and hybridized with cDNA from skeletal muscle of NGT, IGT and T2D P. obesus.
Initial screening of the P. obesus red gastrocnemius library
A total of 1600 clones were generated using the SST. Initial sequencing of 163 randomly selected clones identified 71 transcripts with homology to known genes (Table 1). Of these, 41 were determined by SignalP to contain a signal peptide. An additional 10 proteins were predicted by SecretomeP to be secreted, possibly through non-classical secretory pathways. The 71 genes consisted of four cytokines (6%), 11 secreted proteins (15%), eight receptors (11%), 21 intracellular vesicle membrane proteins (30%), 22 cytosolic/miscellaneous proteins (31%) and five mitochondrial proteins (7%). It is interesting to note that the SST technology identifies genes encoding proteins that may be either secreted or membrane-bound, as both types of proteins can result in the presentation of IL-3 to the FDCP1 cells and facilitate survival of the cells. In this project, however, we focused on identifying secreted proteins. The range of proteins listed above provides evidence that the technology was successful in identifying a range of proteins that are secreted by skeletal muscle in P. obesus.
Identification of differentially expressed secreted proteins using cDNA microarrays
To identify secreted skeletal muscle proteins associated with obesity and diabetes, a cDNA microarray was constructed using the 1600-positive SST cDNA clones. Cy5-labelled P. obesus red gastrocnemius skeletal muscle cDNA from individual NGT, IGT and T2D animals (n=6–7 per group) were hybridized to the microarrays in combination with Cy3-labelled reference cDNA. Analysis of gene expression identified 91 clones that were differentially expressed between groups. These clones were sequenced and a total of 51 genes were identified (Table 2). Examples of differentially expressed genes previously associated with obesity and T2D included complement component 1, r component (C1r), calsequestrin (Casq1) and secreted protein, acidic, cysteine-rich protein (Sparc).25, 26, 27, 28
Additional bioinformatics identified four candidate genes not previously associated with metabolic disease for further study. These genes were sushi domain containing 2 (Susd2, NM_019601), collagen and calcium-binding EGF domains 1 (Ccbe1, NM_133459), periostin (Postn, NM_006475) and decorin (Dcn, NM_133503). All selected genes contained a recognizable signal peptide.
Further gene expression analysis by RT-PCR
To confirm the differential expression observed in the cDNA microarrays and extend the analysis to include fasted animals, RT-PCR was performed on C1r, Susd2, Ccbe1 and Postn genes in P. obesus red gastrocnemius skeletal muscle.
C1r gene expression was significantly increased (by 195%) in obese T2D compared with lean NGT P. obesus in the fed state (P=0.020), and there was a significant correlation between C1r gene expression and body weight (r2=0.20, P=0.035) (Figure 2a). This is consistent with the microarray result. In the fasted state, C1r gene expression was significantly increased (by 314 and 199%, respectively) in obese T2D compared with lean NGT and IGT P. obesus (P=0.005, P=0.027, respectively). Furthermore, skeletal muscle expression of C1r in fasted animals was significantly correlated with body weight (r2=0.30, P=0.010) and plasma insulin concentration (r2=0.48, P=0.001).
As seen on the microarrays, Susd2 gene expression was significantly lower in T2D compared with IGT fed P. obesus (P=0.014) (Figure 2b). However, in the fasted state, Susd2 gene expression was significantly higher in T2D compared with NGT and IGT animals (P=0.004 and P=0.001, respectively) and was significantly correlated with body weight (r2=0.18, P=0.018) and plasma insulin concentration (r2=0.33, P=0.004).
There were no significant differences in Ccbe1 gene expression between fed P. obesus groups by RT-PCR. The magnitude of the differences between the groups according to the microarray data were smaller than for C1r or Susd2. In the fasted state Ccbe1 gene expression was significantly higher in T2D compared with NGT and IGT animals (P=0.013 and P=0.031, respectively) and was significantly correlated with body weight (r2=0.24, P=0.020), and plasma insulin concentration (r2=0.32, P=0.006) (Figure 2c).
Postn gene expression was significantly higher in fed T2D animals compared with NGT animals (P=0.011), consistent with the microarray result (Figure 2d). In the fasted state, Postn gene expression was significantly correlated with plasma insulin concentration (r2=0.24, P=0.018).
Dcn gene expression was associated with obesity, and has been described in detail elsewhere.21
Periostin: a secreted protein not previously associated with obesity and type 2 diabetes
This study has shown for the first time that Postn was associated with obesity and type 2 diabetes in P. obesus, as indicated by the elevated gene expression in red gastrocnemius skeletal muscle from T2D compared with NGT animals. Therefore, Postn gene expression was characterized further in a variety of P. obesus tissues by RT-PCR (Figure 3). Postn gene expression was detected in most P. obesus tissues examined, with high expression observed in adipose tissue, lung and ovary. Although the original aim of this study was to identify secreted proteins from skeletal muscle, the striking expression of Postn within adipose tissue led us to characterize Postn expression further within this tissue.
Postn gene expression was analyzed in visceral (mesenteric) and subcutaneous (subscapular) adipose tissue from NGT, IGT and T2D fed P. obesus. Overall, Postn mRNA expression was higher in visceral compared with subcutaneous adipose tissue (P=0.007). This was also evident in the separate groups, reaching significance in the NGT animals (P=0.004) (Figure 4). Postn gene expression was significantly higher in T2D P. obesus than NGT animals in both visceral and subcutaneous adipose tissue (P=0.026 and P<0.001, respectively). In visceral adipose tissue, Postn gene expression was significantly correlated with blood glucose concentration (r2=0.42, P=0.006). In subcutaneous adipose tissue, Postn gene expression was significantly correlated with body weight (r2=0.45, P=0.005), blood glucose levels (r2=0.30, P=0.028), plasma insulin concentration (r2=0.28, P=0.037) and percent body fat (r2=0.35, P=0.021). These results demonstrate that Postn gene expression was elevated in both subcutaneous and visceral adipose tissue in obese T2D P. obesus, with elevated expression in visceral adipose tissue compared with subcutaneous adipose tissue.
To determine which cells within adipose tissue were responsible for Postn expression, visceral (mesenteric) adipose depots from P. obesus were fractionated into adipocytes and stromal/vascular cells. RT-PCR of leptin (Lep) and Dlk1 was performed on cDNA from the fractions and confirmed efficient fractionation. Lep gene expression was substantially higher in adipocytes compared with stromal/vascular cells (P<0.001), and Dlk1 gene expression was higher in stromal/vascular cells compared with adipocytes (P=0.022) (data not shown). Postn gene expression was analyzed by RT-PCR in these fractions and was found to be significantly higher in the adipocyte fraction compared with the stromal/vascular fraction (P=0.004) (Figure 5).
Discussion
During the development of insulin resistance and type 2 diabetes glucose, homoeostasis becomes dysregulated, and adipose tissue and skeletal muscle produce secretory factors that act in an autocrine or paracrine fashion to help regulate blood glucose levels. 6 In this study, we sought to identify differentially expressed skeletal muscle genes encoding secreted proteins in P. obesus. Although P. obesus is an excellent animal model to investigate obesity and type 2 diabetes,18, 19, 20 a conventional bioinformatics approach to identify secreted proteins in P. obesus was not possible as it relies on detailed genomic sequence which is currently unavailable for this animal model. We therefore developed a novel methodology that combined an SST with cDNA microarray technology to identify genes encoding secreted proteins that were differentially expressed in the skeletal muscle of normal glucose tolerant, overweight and impaired glucose tolerant and obese type 2 diabetic groups of P. obesus.
The SST library was constructed from red gastrocnemius skeletal muscle. This metabolically important tissue has been extensively studied in relation to processes and pathways contributing to the development of insulin resistance and type 2 diabetes. It must be noted that tissue type, and more significant to our study, muscle and fibre type, would likely substantively alter the SST profile. In addition, we wished to analyze any potential roles of genes in a variety of metabolic processes, for example, nutritional regulation. Therefore, skeletal muscle from fed and fasted P. obesus was utilized for SST library construction and gene expression analysis as there are vast differences in metabolic homoeostasis that occur during fed (absorptive) and fasted (postabsorptive) states.
Sequencing of random clones produced from the skeletal muscle SST library resulted in the identification of 71 genes with homology to known genes. Bioinformatics analysis of the closest orthologues of these genes identified 41 genes with known signal peptides and a further 10 were predicted by the SignalP algorithm to be secreted or membrane-bound. These data show that the majority of SST clones were likely to be secreted or membrane-bound, and validated the decision to proceed with screening these genes for differential expression in skeletal muscle by microarray analysis. It should be acknowledged that ‘validation’ by bioinformatics analysis is not as conclusive as demonstration of secretion by experimentation; however, practical considerations prevented doing this for all 71 genes in this study. Of the 51 SST genes found to be differentially expressed between T2D and NGT P. obesus, 24 of these genes were not previously known to encode secreted proteins. A traditional bioinformatics approach would not have identified approximately 50% of these differentially expressed genes.
A number of false positives were generated by the SST. Previous SST studies have found a 25 to 50% false-positive rate,29, 30, 31, 32 which results from incomplete enrichment of cDNA libraries for secreted proteins, as well as inclusion of transcription factors and oncogenes that may permit mIL-3 secretion or enable the cells to grow in the absence of mIL-3. Some genes identified, such as those encoding mitochondrial proteins, contain an N-terminal hydrophobic domain that may act as a signal peptide. We are unable to explain the identification of structural proteins, for example profilin and alpha actin; however, these may be due to cDNAs being cloned out of frame or in antisense orientation revealing cryptic open-reading frames encoding hydrophobic amino-acid sequences that may act as signal peptides. Generation of false positives is a limitation of SST that needs to be considered when designing studies incorporating this technology.
Microarray analysis of the 1600 SST clones allowed comparison of gene expression between different P. obesus groups. The gene expression changes were not large, especially between the IGT animals and other groups, however this is consistent with previous reports which found gene expression changes in skeletal muscle of subjects with diabetes to be small in magnitude.33, 34, 35 Moreover, the identification of genes previously associated with diabetes and obesity, such as Sparc28 and C1r,25, 26 provided evidence to validate the use of a combined SST and cDNA microarray technology to identify secreted proteins differentially expressed in obesity and type 2 diabetes. This study is based upon gene expression, therefore further experiments are required to demonstrate that the proteins identified are bona fide secreted proteins and investigate their role in obesity and type 2 diabetes.
A number of genes identified using the combined microarray analysis of SST clones have previously been shown to be highly expressed in adipose tissue. These observations raised the possibility that the detected expression of these genes was a result of contamination of skeletal muscle by interstitial adipocytes within the skeletal muscle in tissue samples. To test this possibility, we measured gene expression of adipose-specific fatty acid-binding protein 4 (Fabp4), which is predominantly and highly expressed in adipocytes and highly regulated during adipocyte differentiation36, 37, 38 in the same skeletal muscle samples used to confirm differential expression. The RT-PCR revealed no detectable Fabp4 expression in any of three animal groups (data not shown), suggesting that the genes isolated do originate from skeletal muscle tissue itself, and not from contaminating interstitial adipocytes.
The 51 differentially expressed genes consisted of three cytokines, seven secreted proteins, 11 receptors, cell surface and ion channel activity genes, 15 intracellular membrane vesicle proteins and 15 cytosolic and miscellaneous proteins. These genes are involved in a diverse range of cellular processes and therefore, this technology could be potentially applied to any disease state. In depth bioinformatics and gene ontology analysis of the differentially expressed genes resulted in the identification of four secreted proteins potentially associated with obesity and type 2 diabetes. These genes were Susd2, Ccbe1, Dcn and Postn. We explored the biology of Dcn in detail and found that in addition to it being expressed in muscle, it was highly expressed in adipose tissue by non-adipocytes adjacent to adipose tissue vasculature.21 Currently, the biological functions of Susd2 and Ccbe1 are relatively unknown, therefore these genes represent promising candidates for further functional characterization to determine their potential role in the development of obesity and type 2 diabetes.
Of the genes differentially expressed between the skeletal muscle of diabetic and lean, healthy P. obesus, Postn was the most interesting. Postn is a secreted protein that is involved in cell attachment, adhesion and differentiation.39, 40, 41, 42, 43, 44 It has recently been added to the matricellular class of proteins,45 which are a group of extracellular matrix related molecules that modulate cell–matrix interactions.46 Matricellular proteins are expressed at high levels during development, but are typically limited to wound repair, tissue remodelling or disease in postnatal tissue, where their levels increase substantially.45 Postn has previously been shown to be expressed in skeletal muscle in states of repair,47 and is essential for healing of cardiac muscle after acute myocardial infarction.48 Sparc, another matricellular protein that has been previously found to have increased gene expression in diabetes-related vascular hypertrophy,28 was also found to be upregulated in diabetic P. obesus skeletal muscle by microarray in this study. It is therefore tempting to speculate that Postn may have a homoeostatic role in the response of muscle to type 2 diabetes; however, further studies are clearly required to show such a role.
This study reveals, for the first time, high expression of Postn in adipose tissue of P. obesus. Although the original aim was to identify and subsequently characterize skeletal muscle-derived secreted proteins during the development of obesity and type 2 diabetes, the striking gene expression of Postn within adipose tissue led us to characterize Postn further within this depot. Fractionation studies demonstrated that the expression was in the adipocytes rather than in the stromal or vascular cells. Expression of Postn was higher in obese, diabetic P. obesus than lean, healthy animals in both visceral and subcutaneous depots. This suggests that, as in skeletal muscle, Postn may be involved in repair or be required for expansion of the adipose tissue, having a role in extracellular matrix remodelling, cellular adhesion or adipocyte differentiation. Adipose tissue growth requires extensive vascularization to enable correct tissue functionality,49 and Postn is known to have a role in angiogenesis.50 Of particular interest was the increased Postn expression in visceral compared with subcutaneous adipose tissue in P. obesus as it is well established that visceral adipose tissue accumulation is associated with the development of insulin resistance and type 2 diabetes.51, 52, 53, 54 It should be noted that the correlation between Postn expression and body weight does not provide conclusive evidence that adipose tissue is the major source of circulating periostin, and this remains to be empirically determined.
In conclusion, we have shown that the novel methodology of SST in conjunction with cDNA microarray technology is a powerful tool to identify differentially expressed secreted proteins in red gastrocnemius muscle from NGT, IGT and T2D P. obesus. A number of candidate genes including Postn were identified and provide evidence of the value of this methodology not only for identification of secreted proteins in obesity and type 2 diabetes, but potentially also for a variety of other disease states
Conflict of interest
The authors declare no conflict of interest.
References
O'Rahilly S, Barroso I, Wareham NJ . Genetic factors in type 2 diabetes: the end of the beginning? Science 2005; 307: 370–373.
Kahn CR . Banting Lecture. Insulin action, diabetogenes, and the cause of type II diabetes. Diabetes 1994; 43: 1066–1084.
Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG . Central nervous system control of food intake. Nature 2000; 404: 661–671.
Stryer L. Biochemistry 3rd edn. W.H. Freeman and Company, New York, 1988.
Kamei Y, Miura S, Suzuki M, Kai Y, Mizukami J, Taniguchi T et al. Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated Type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J Biol Chem 2004; 279: 41114–41123.
Nishizawa H, Matsuda M, Yamada Y, Kawai K, Suzuki E, Makishima M et al. Musclin, a novel skeletal muscle-derived secretory factor. J Biol Chem 2004; 279: 19391–19395.
Pedersen BK, Steensberg A, Fischer C, Keller C, Keller P, Plomgaard P et al. The metabolic role of IL-6 produced during exercise: is IL-6 an exercise factor? Proc Nutr Soc 2004; 63: 263–267.
Pedersen BK, Steensberg A, Fischer C, Keller C, Keller P, Plomgaard P et al. Searching for the exercise factor: is IL-6 a candidate? J Muscle Res Cell Motil 2003; 24: 113–119.
McPherron AC, Lawler AM, Lee SJ . Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997; 387: 83–90.
Massague J, Cheifetz S, Endo T, Nadal-Ginard B . Type beta transforming growth factor is an inhibitor of myogenic differentiation. Proc Natl Acad Sci USA 1986; 83: 8206–8210.
Horsley V, Jansen KM, Mills ST, Pavlath GK . IL-4 acts as a myoblast recruitment factor during mammalian muscle growth. Cell 2003; 113: 483–494.
Busquets S, Figueras M, Almendro V, Lopez-Soriano FJ, Argiles JM . Interleukin-15 increases glucose uptake in skeletal muscle. An antidiabetogenic effect of the cytokine. Biochim Biophys Acta 2006; 1760: 1613–1617.
Febbraio MA, Hiscock N, Sacchetti M, Fischer CP, Pedersen BK . Interleukin-6 is a novel factor mediating glucose homeostasis during skeletal muscle contraction. Diabetes 2004; 53: 1643–1648.
Carey AL, Steinberg GR, Macaulay SL, Thomas WG, Holmes AG, Ramm G et al. Interleukin-6 increases insulin-stimulated glucose disposal in humans and glucose uptake and fatty acid oxidation in vitro via AMP-activated protein kinase. Diabetes 2006; 55: 2688–2697.
Chan MH, Carey AL, Watt MJ, Febbraio MA . Cytokine gene expression in human skeletal muscle during concentric contraction: evidence that IL-8, like IL-6, is influenced by glycogen availability. Am J Physiol Regul Integr Comp Physiol 2004; 287: R322–R327.
Al-Khalili L, Bouzakri K, Glund S, Lonnqvist F, Koistinen HA, Krook A . Signaling specificity of interleukin-6 action on glucose and lipid metabolism in skeletal muscle. Mol Endocrinol 2006; 20: 3364–3375.
Kim HJ, Higashimori I, Park SY, Choi H, Dong J, Kim YJ et al. Differential effects of interleukin-6 and -10 on skeletal muscle and liver insulin action in vivo. Diabetes 2004; 53: 1060–1067.
Barnett M, Collier GR, Collier FM, Zimmet P, O′Dea KA . cross-sectional and short-term longitudinal characterisation of NIDDM in Psammomys obesus. Diabetologia 1994; 37: 671–676.
Walder KR, Fahey RP, Morton GJ, Zimmet PZ, Collier GR . Characterization of obesity phenotypes in Psammomys obesus (Israeli sand rats). Int J Exp Diabetes Res 2000; 1: 177–184.
Collier GR, McMillan JS, Windmill K, Walder K, Tenne-Brown J, de Silva A et al. Beacon: a novel gene involved in the regulation of energy balance. Diabetes 2000; 49: 1766–1771.
Bolton K, Segal D, McMillan J, Jowett J, Heilbronn L, Abberton K et al. Decorin is a secreted protein associated with obesity and type 2 diabetes. Int J Obes (London) 2008; 32: 1113–1121.
Karasuyama H, Rolink A, Melchers F . Recombinant interleukin 2 or 5, but not 3 or 4, induces maturation of resting mouse B lymphocytes and propagates proliferation of activated B cell blasts. J Exp Med 1988; 167: 1377–1390.
Spooncer E, Heyworth CM, Dunn A, Dexter TM . Self-renewal and differentiation of interleukin-3-dependent multipotent stem cells are modulated by stromal cells and serum factors. Differentiation 1986; 31: 111–118.
Morita S, Kojima T, Kitamura T . Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Therapy 2000; 7: 1063–1066.
Zhang J, Wright W, Bernlohr DA, Cushman SW, Chen X . Alterations of the classic pathway of complement in adipose tissue of obesity and insulin resistance. Am J Physiol Endocrinol Metab 2007; 292: E1433–E1440.
Gabrielsson BG, Johansson JM, Lonn M, Jernas M, Olbers T, Peltonen M et al. High expression of complement components in omental adipose tissue in obese men. Obes Res 2003; 11: 699–708.
Howarth FC, Glover L, Culligan K, Qureshi MA, Ohlendieck K . Calsequestrin expression and calcium binding is increased in streptozotocin-induced diabetic rat skeletal muscle though not in cardiac muscle. Pflugers Arch 2002; 444: 52–58.
Jandeleit-Dahm K, Rumble J, Cox AJ, Kelly DJ, Dziadek M, Cooper ME et al. SPARC gene expression is increased in diabetes-related mesenteric vascular hypertrophy. Microvasc Res 2000; 59: 61–71.
Taft RA, Denegre JM, Pendola FL, Eppig JJ . Identification of genes encoding mouse oocyte secretory and transmembrane proteins by a signal sequence trap. Biol Reprod 2002; 67: 953–960.
Jacobs KA, Collins-Racie LA, Colbert M, Duckett M, Golden-Fleet M, Kelleher K et al. A genetic selection for isolating cDNAs encoding secreted proteins. Gene 1997; 198: 289–296.
Chen H, Leder P . A new signal sequence trap using alkaline phosphatase as a reporter. Nucleic Acids Res 1999; 27: 1219–1222.
Mitchell KJ, Pinson KI, Kelly OG, Brennan J, Zupicich J, Scherz P et al. Functional analysis of secreted and transmembrane proteins critical to mouse development. Nat Genet 2001; 28: 241–249.
Frederiksen CM, Hojlund K, Hansen L, Oakeley EJ, Hemmings B, Abdallah BM et al. Transcriptional profiling of myotubes from patients with type 2 diabetes: no evidence for a primary defect in oxidative phosphorylation genes. Diabetologia 2008; 51: 2068–2077.
Mootha VK, Lindgren CM, Eriksson K-F, Subramanian A, Sihag S, Lehar J et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 2003; 34: 267–273.
Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S et al. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc Natl Acad Sci USA 2003; 100: 8466–8471.
Spiegelman BM, Frank M, Green H . Molecular cloning of mRNA from 3T3 adipocytes. Regulation of mRNA content for glycerophosphate dehydrogenase and other differentiation-dependent proteins during adipocyte development. J Biol Chem 1983; 258: 10083–10089.
Bernlohr DA, Doering TL, Kelly Jr TJ, Lane MD . Tissue specific expression of p422 protein, a putative lipid carrier, in mouse adipocytes. Biochem Biophys Res Commun 1985; 132: 850–855.
Hunt CR, Ro JH, Dobson DE, Min HY, Spiegelman BM . Adipocyte P2 gene: developmental expression and homology of 5′-flanking sequences among fat cell-specific genes. Proc Natl Acad Sci USA 1986; 83: 3786–3790.
Kuhn B, Del Monte F, Hajjar RJ, Chang YS, Lebeche D, Arab S et al. Periostin induces proliferation of differentiated cardiomyocytes and promotes cardiac repair. Nat Med 2007; 13: 962–969.
Horiuchi K, Amizuka N, Takeshita S, Takamatsu H, Katsuura M, Ozawa H et al. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J Bone Miner Res 1999; 14: 1239–1249.
Tai IT, Dai M, Chen LB . Periostin induction in tumor cell line explants and inhibition of in vitro cell growth by anti-periostin antibodies. Carcinogenesis 2005; 26: 908–915.
Sasaki H, Dai M, Auclair D, Kaji M, Fukai I, Kiriyama M et al. Serum level of the periostin, a homologue of an insect cell adhesion molecule, in thymoma patients. Cancer Lett 2001; 172: 37–42.
Bao S, Ouyang G, Bai X, Huang Z, Ma C, Liu M et al. Periostin potently promotes metastatic growth of colon cancer by augmenting cell survival via the Akt/PKB pathway. Cancer Cell 2004; 5: 329–339.
Gillan L, Matei D, Fishman DA, Gerbin CS, Karlan BY, Chang DD et al. Periostin secreted by epithelial ovarian carcinoma is a ligand for alpha(V)beta(3) and alpha(V)beta(5) integrins and promotes cell motility. Cancer Res 2002; 62: 5358–5364.
Hamilton DW . Functional role of periostin in development and wound repair: implications for connective tissue disease. J Cell Commun Signal 2008; 2: 9–17.
Bornstein P . Matricellular proteins: an overview. Matrix Biol 2000; 19: 555–556.
Goetsch SC, Hawke TJ, Gallardo TD, Richardson JA, Garry DJ . Transcriptional profiling and regulation of the extracellular matrix during muscle regeneration. Physiol Genomics 2003; 14: 261–271.
Shimazaki M, Nakamura K, Kii I, Kashima T, Amizuka N, Li M et al. Periostin is essential for cardiac healing after acute myocardial infarction. J Exp Med 2008; 205: 295–303.
Hutley LJ, Herington AC, Shurety W, Cheung C, Vesey DA, Cameron DP et al. Human adipose tissue endothelial cells promote preadipocyte proliferation. Am J Physiol Endocrinol Metab 2001; 281: E1037–E1044.
Shao R, Bao S, Bai X, Blanchette C, Anderson RM, Dang T et al. Acquired expression of periostin by human breast cancers promotes tumor angiogenesis through up-regulation of vascular endothelial growth factor receptor 2 expression. Mol Cell Biol 2004; 24: 3992–4003.
Carr DB, Utzschneider KM, Hull RL, Kodama K, Retzlaff BM, Brunzell JD et al. Intra-abdominal fat is a major determinant of the National Cholesterol Education Program Adult Treatment Panel III criteria for the metabolic syndrome. Diabetes 2004; 53: 2087–2094.
Wajchenberg BL . Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. Endocr Rev 2000; 21: 697–738.
Moller DE, Kaufman KD . Metabolic syndrome: a clinical and molecular perspective. Annu Rev Med 2005; 56: 45–62.
Liu KH, Chan YL, Chan WB, Chan JC, Chu CW . Mesenteric fat thickness is an independent determinant of metabolic syndrome and identifies subjects with increased carotid intima-media thickness. Diabetes Care 2006; 29: 379–384.
Acknowledgements
This work was financially supported by ChemGenex Pharmaceuticals (Geelong, Victoria, Australia). Kristy Bolton was a recipient of a Deakin University postgraduate scholarship.
We gratefully acknowledge Adrian Cooper for his valuable technical assistance with the animal studies, and Ivano Broz for assistance with the bioinformatics analysis.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Bolton, K., Segal, D., McMillan, J. et al. Identification of secreted proteins associated with obesity and type 2 diabetes in Psammomys obesus. Int J Obes 33, 1153–1165 (2009). https://doi.org/10.1038/ijo.2009.148
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/ijo.2009.148
Keywords
This article is cited by
-
A comparison between the abdominal and femoral adipose tissue proteome of overweight and obese women
Scientific Reports (2019)
-
Psammomys obesus: a Natural Diet-Controlled Model for Diabetes and Cardiovascular Diseases
Current Atherosclerosis Reports (2018)
-
Weight Regain Following Intentional Weight Loss in Older Adults
Current Nutrition Reports (2016)
-
Gingival Crevicular Fluid and Salivary Periostin Levels in Non-Smoker Subjects With Chronic and Aggressive Periodontitis
Inflammation (2016)
-
Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner
Genes & Nutrition (2015)