Abstract
After identifying a 10-year-old boy with inherited long QT syndrome (LQTS) after a near-drowning that required defibrillation from torsades de pointes, evaluation of first degree relatives revealed a four-generation kindred comprising 26 individuals with four additional symptomatic and eight asymptomatic members harboring an abnormally prolonged QTc (defined as≥0.46 s1/2). We set out to determine the molecular basis of their LQTS. The inherited LQTS represents a collection of genetically distinct ion channelopathies with over 40 mutations in four fundamental cardiac ion channels identified. Molecular studies, including linkage analysis and identification of the disease-associated mutation, were performed on genomic DNA isolated from peripheral blood samples from 29 available family members. Genetic linkage analysis excluded the regions for LQT2, LQT3, and LQT5. However, the chromosome 11p15.5 region (LQT1) showed evidence of linkage with a maximum lod score of 3.36. Examination of the KVLQT1 gene revealed a novel 3-bp deletion resulting in an in-frame ΔF339 (phenylalanine) deletion in the proband. This ΔF339 mutation was confirmed in nine additional family members who shared both an assigned affected phenotype and the disease-associated linked haplotype. Importantly, three asymptomatic family members, with a tentative clinical diagnosis based on their QTc, did not have this mutation and could be reclassified as unaffected. It is noteworthy that the proband's ECG suggested the sodium channel-based LQT3 genotype. These findings show the potential importance of establishing a molecular diagnosis rather than initiating genotype-specific interventions based upon inspection of a patient's ECG.
Similar content being viewed by others
Main
Molecular breakthroughs in the 1990s have elevated the inherited LQTS from its previous clinical descriptions as the autosomal recessive Jervell and Lange-Nielsen syndrome associated with deafness and the autosomal dominant Romano-Ward syndrome to a diverse collection of cardiac ion channelopathies(1). Autosomal dominant LQTS is estimated to occur in 1 per 10,000 persons and is speculated to account for nearly half of the 8000 yearly sudden deaths in children. In addition, LQTS, with its perturbed cardiac ion channel genes, provides a molecular model to explore the basis for one form of ventricular arrhythmogenesis that is implicated in a portion of the approximately 300,000 sudden cardiac deaths in the United States each year(2,3).
Marked QT prolongation (QTc ≥ 0.46 s1/2 considered abnormal), symptoms including syncope, seizures, and sudden death, and the polymorphic ventricular tachyarrhythmia known as torsades de pointes comprise the clinical trademarks of inherited LQTS. On a molecular level, over 40 mutations in four cardiac ion channel genes have been identified thus far; KVLQT1 (voltage-gated K channel gene) on chromosome 11p15.5 (LQT1), HERG (human ether-a-go-go related gene) on chromosome 7q35-36 (LQT2), SCN5A on chromosome 3p21-24 (LQT3), and KCNE1 (minK) on chromosome 21q22.1-22.2(LQT5)(4).
Translational research into genotype-phenotype correlations has resulted in the prospect of asymptomatic molecular genetic testing and genotype-targeted therapeutic interventions. For instance, mexiletine may be a useful adjunct to β-blocker therapy in patients having the sodium channel-based LQT3 genotype(5,6). Analyses of ECGs from patients having the LQT1, LQT2, or LQT3 genotypes have been reported to show characteristic patterns for each of the genotypes, namely prolonged T waves (LQT1), small T waves (LQT2), and prolonged QTonset parameters (LQT3)(7). It may be tempting to speculate that prediction of underlying genotype and therefore initiation of genotype-specific therapies may be possible by careful scrutiny of the patient's ECG. For example, if a patient with inherited LQTS has the stereotyped ECG pattern consistent with LQT3, should mexiletine be added to the patient's treatment regimen?
Recently, Ackerman and Porter(8) identified a four-generation kindred with an autosomal dominant form of inherited LQTS. Although several adults were shown subsequently to be affected, the diagnosis of LQTS was established after a near-drowning of a 10-y-old boy who required defibrillation from torsades de pointes ventricular tachyarrhythmia(8). Analysis of the proband's ECG pattern predicted the sodium channel-based LQT3 (Fig. 1). However, we discovered linkage of this family to the chromosome 11p15.5 LQT1 region rather than the chromosome 3p21-24 LQT3 region as predicted by the ECG pattern. Here, we report the characterization of a novel mutation in the KVLQT1 (LQT1) gene as the molecular basis for this family's inherited LQTS.
METHODS
Identifying and phenotyping the near-drowning LQTS patient's family. After establishing the diagnosis of LQTS in the proband (lead II QTc = 0.56 s1/2), we obtained ECGs from 29 family members(8). For purposes of linkage analysis, a conservative definition of affected status was used consistent with previous LQTS linkage studies(9,10). A patient was classified phenotypically as affected if they met either of the following two conditions: 1) symptoms plus a QTc ≥ 0.45 s1/2 or 2) QTc ≥ 0.47 s1/2. Unaffected status was given if the patient was asymptomatic and had a QTc ≤ 0.41 s1/2. Finally, a patient was classified as"uncertain" if they either were 1) asymptomatic with a QTc between 0.41 and 0.47 s1/2 or had 2) symptoms but a QTc ≤ 0.44 s1/2. After approval by Mayo Clinic's Department of Pediatrics and Adolescent Medicine's Research Committee and the Mayo Foundation Institutional Review Board, written informed consent was obtained from all participants or their guardians, and blood samples were provided by nearly every available family member (29 of 30).
Genotyping and linkage analyses. Genomic DNA was isolated from the peripheral blood lymphocytes using standard procedures(11). The genomic DNA was genotyped using PCR amplification of 11 polymorphic microsatellite markers that had been linked previously to four LQTS ion channel gene loci: D11S922, D11S4046, and D11S1318 localized to chromosome 11p15.5 (LQT1)(12,13); D7S505, D7S636, and D7S483 localized to chromosome 7q35-36 (LQT2)(10,14); D3S1298, D3S1100, and D3S1767 localized to chromosome 3p21-24 (LQT3)(10); and D21S65 and D21S219 localized to chromosome 21q22.1-22.2 (LQT5)(15). We did not screen for the LQT4 locus on chromosome 4q25-27 as that locus has been identified in only one family to date and a candidate gene has not been established(16).
Amplification of these microsatellite markers used PCR. Foward primers were labeled with phosphoramidite dyes. Each 15-µL reaction contained 50 ng of genomic DNA, 200 µM dNTPs, 8 µM each primer, 0.5 U of Amplitaq Gold (Perkin-Elmer), and 2.5 mM MgCl2. Reactions were cycled in a Perkin-Elmer GeneAmp PCR System 9600 as follows: 10 min at 95°C; then 35 cycles of 30 s at 95°C, 30 s at 55°C, 30 s at 72°C; followed by an extension step of 10 min at 72°C. PCR reactions were held at 4°C until analysis. The PCR products were resolved on a 5% denaturing polyacrylamide gel and detected using an ABI377 DNA sequencer. Genotypes were analyzed using ABI Genescan 2.1 and ABIGenotyper 2.0.
Pairwise linkage analysis was performed using MLINK in the LINKAGE 5.1 software package(17). Similar to previous LQTS linkage studies(9,10), the disease penetrance was set at 0.9 and the LQTn disease gene frequency was assumed to be 0.001 and equal between male and female subjects. The allele frequencies for each DNA marker were assumed to be equally frequent.
Gene mutation identification. Six exons of the KVLQT1 gene encoding most of the transmembrane spanning segments and channel pore (S2-S6) were amplified for DNA sequence analyses. Oligonucleotide sequences for the six primer pairs have been published previously by Wang et al.(13). Each 25-µL PCR included 50 ng of genomic DNA and 20 µM each primer, and cycling conditions were: 5 min at 94°C; then 5 cycles of 20 s at 94°C, 20 s at 64°C, 30 s at 72°C; then 30 cycles of 20 s at 94°C, 20 s at 62°C, 30 s at 72°C; followed by an extension step of 10 min at 72°C (Q. Wang, personal communication, 1998). PCR products were cleaned using the Wizard system (Promega, Madison, WI). The six PCR products from the proband and his unaffected brother were sequenced in both directions using the same primers as used for the first round PCR amplification. DNA sequencing was performed on the ABI377 using approximately 30-100 ng of PCR template and 3.2 pmol of primer. Sequence analysis of the exon encoding the pore-S6 segment of the channel (forward primer, AGGCTGACCACTGTCCCTCT, and reverse primer, CCCCAGGACCCCAGCTGTCCAA) suggested the presence of a deletion event in the affected proband.
ThermoSequenase sequencing (Amersham Life Science, Cleveland, OH) with33 P-labeled ddNTPs was used to define the proband's deletion-mutation. The exon encoding this pore-S6 segment was again amplified by PCR using the afore-mentioned primer pair with the same annealing conditions. The PCR product was enzymatically treated and sequenced in both directions using the same primers as in the initial amplification. The annealing temperature for the 33P-sequencing reaction was 58°C. Samples were run on a 6% denaturing acrylamide gel.
RESULTS
Near-drowning patient's family is linked to chromosome 11p15.5(LQT1). Of the four established LQTS ion channelopathies, linkage studies excluded linkage to the LQT2 (7q35-36), LQT3 (3p21-24), and LQT5(21q22.1-22.2) regions (data not shown). However, there was evidence of linkage to the chromosome 11p15.5 LQT1 locus (Fig. 2) The maternally inherited haplotype 114-190-132 for the DNA markers, D11S922, D11S4046, and D11S1318, co-segregated with the patient's phenotypic status. Two-point linkage analysis demonstrated linkage to these markers with maximum lod scores of 2.07, 3.36, and 2.96 for the markers D11S922, D11S4046, and D11S1318, respectively (Table 1). Each clinically affected patient (proband IV-1, III-1, III-5, III-9, III-11, II-2, II-3, II-5, and II-7) except a maternal aunt (III-4) shared this particular haplotype. The maternal aunt's (III-4) haplotype (126-190-132) represents a recombination event between the markers D11S922 and D11S4046. The candidate gene, KV-LQT1, resides between the D11S922 and D11S4046 markers. This indicates that the recombination event must have occurred telomeric to the location of the mutant KVLQT1 gene. None of the three living individuals who were assigned an uncertain clinical status (I-2, III-2, and IV-3) shared this disease-associated haplotype. Given this chromosome 11p15.5 linkage, the presence of a mutation in the LQT1 gene (KVLQT1) was sought.
A novel 3-bp deletion in KVLQT1 in the proband is identified. Six exons from the KVLQT1 gene encoding much of the transmembrane spanning ion channel (from S2 through S6) were amplified and sequenced using previously published primers(13). Evaluation of this region of the KVLQT1 gene was chosen as it encodes important functional elements of the ion channel and the majority of LQT1 mutations previously reported are found in this region. The DNA sequences between the proband(IV-1) and his unaffected brother (IV-2) were compared. A 3-bp nucleotide deletion [(Δaag) as shown from the minus strand in Fig. 3] was discovered in the proband's exon that encodes the latter half of the channel pore and most of the final (S6) transmembrane spanning segment (from V308 to A344) (Fig. 3). This 3-bp deletion results in an in-frame deletion of a single amino acid(phenylalanine), ΔF339, without any further disruption of the KVLQT1 potassium channel.
Presence of ΔF339-KVLQT1 mutation confirmed in family members predicted to have inherited LQTS by clinical phenotype and linkage haplotype. Finally, a PCR-based assay was developed to determine the presence or absence of the deletion-containing mutant in the rest of the family (Fig. 4). Using the primers specific for amplifying the exon encoding amino acids 308 through 344, each family member's amplicon was electrophoresed on an 8% acrylamide gel and stained with ethidium bromide. As shown in Figure 4, the abnormal banding pattern (heteroduplex) was identical in the proband, and each of the clinically affected family members who also shared the disease-associated haplotype. This defining band pattern was indeed present in the maternal aunt(III-4, Fig. 2) with the presumed recombination event but was absent in the three individuals (I-2, III-2, and IV-3, Fig. 2) whose clinical status was uncertain. Direct sequence analysis from the nine individuals who shared the proband's heteroduplex pattern confirmed the identical 3-bp deletion (data not shown).
DISCUSSION
Ackerman and Porter(8) previously reported the identification of this autosomal dominant inherited LQTS family after a near-drowning of a 10-y-old white boy in a public pool while racing his younger brother(8). This index patient was defibrillated successfully from a torsades de pointes polymorphic ventricular tachyarrhythmia at the poolside. Careful evaluation of the family (history and screening ECG) suggested the inherited LQTS. Evaluations of first degree relatives revealed four additional symptomatic individuals each with an abnormal QTc (≥0.46 s1/2) and eight family members with no previous symptoms compatible with LQTS but a screening ECG with either a borderline QTc (between 0.42 and 0.46 s1/2) or an abnormal QTc. The proband's ECG pattern (Fig. 1) suggested a LQT3-sodium channel-based genotype(7).
We provide molecular genetic evidence that a novel mutation in KVLQT1 is the molecular basis for this family's inherited LQTS (LQT1, Fig. 5). First, polymorphic DNA markers for chromosome 11p15.5-linked LQT1 segregated with clinical disease status with a significant lod score. Furthermore, the 3-bp deletion responsible for theΔF339 mutant in the proband segregated completely with the clinical disease status as well. KVLQT1 is the channel pore-forming subunit that in combination with its β-auxiliary subunit (minK) provides a critical phase 3 repolarizing potassium current, IKs(18–20). The novel mutation reported here adds to the already widespread mutational heterogeneity found within the KVLQT1 gene (reviewed by Ackerman in 1998)(4). The majority of previous mutations(18 of 21) have each been single nucleotide missense mutations(13,21–24). The three exceptions to the missense mutations have included a 3-bp deletion causing a F167W/G168Δ mutation resulting in a severely truncated channel subunit(13); a 3-bp exon-intron boundary deletion and a splicing mutation both leading to premature termination and truncated proteins(24).
The mutation described here is unique to KVLQT1 mutations, an amino acid deletion mutation rather than a missense point mutation. This ΔF339 mutant is in close proximity to the putative LQT1 "hot-spot," A341V/E, accounting for nearly one-third of the LQT1 genetic perturbations in previously described LQT1 families(22,24). This suggests that the sixth transmembrane spanning segment (S6) likely contributes key functional characteristics to the adjacent channel pore. Presently, only three KVLQT1 mutations have been functionally characterized: A178P in the S2-S3 cytoplasmic loop, L273F in S5, and T312I in the channel pore(25). Thus far, the basis for action potential prolongation in LQT1 is through a dominant-negative effect with mutant subunits causing a diminution in the number of fully functional KVLQT1-based IKs channels. It should be noted that the A341V mutation is also denoted in the literature as A212V(13) and as A246V(24) with the initial amino acid positions based upon truncated clones at the N-terminus rather than the now known full-length KVLQT1 clone containing 676 amino acids (129 and 95 additional N-terminal residues respectively)(18).
This study also points to the clinical prospects and need for asymptomatic testing. Importantly, two family members (a maternal aunt III-2 and her son IV-3) were believed to have LQTS based upon their screening ECG (lead II QTc= 0.46 s1/2 for both), despite their asymptomatic clinical status. Although QTc determinations from three large LQT1 families would suggest that this degree of QT prolongation predicts having inherited LQTS with a positive predictive value exceeding 90%(26), this ΔF339 mutation was not present in either individual. Without such molecular testing, asymptomatic individuals like these will be presumed to have inherited this potentially fatal arrhythmogenic condition and may experience anxiety as well as unnecessary and expensive adjustments in their insurability. On the other hand, molecular genetic testing will be important to identify carriers of a gene mutation in those individuals who may otherwise be asymptomatic. Predictive testing for these individuals should help to provide adequate surveillance and proper treatment over time.
Finally, this LQT1 mutation raises an important genotype-phenotype inquiry. Characterization of this novel KVLQT1 mutation underscores the importance for cardiologists to resist the temptation of surmising a particular molecular diagnosis and initiating genotype-specific therapies based upon examination of a patient's ECG. A meticulous study by Moss et al.(7) offered the tantalizing prospect that careful evaluation of the ECG could allow direct diagnosis of genetically distinct forms of the inherited LQTS. In analyzing the ECG from six families with LQTS, two families each for LQT1 (n = 76), LQT2 (n = 30), and LQT3 (n = 47), they found some distinctive ECG repolarization features. Namely, LQT1 individuals had prolonged T wave durations (average = 0.262 s1/2, compared with 0.191 and 0.187 for LQT2 and LQT3, respectively). Small T waves appeared unique for the LQT2 genotype (LQT2 = 0.13 mV compared with 0.37 mV and 0.36 mV on average for LQT1 and LQT3). Individuals with the LQT3 genotype displayed essentially normal T waves that were inscribed after a prolonged ST segment reflected by a QTonset-c averaging around 0.341 s1/2 compared with 0.242(LQT1) and 0.290 (LQT2). Given these distinguishing peculiarities, the proband's ECG (Fig. 1) is consistent with the prototypic LQT3 ECG pattern despite the ΔF339 mutation arising from the KVLQT1 potassium channel-based LQT1.
Given some early promising genotype-specific therapies using mexiletine in patients with LQT3(5,6,27), it may be tempting to diagnose those with LQT3 based upon their ECG pattern and initiate gene-targeted mexiletine therapy. Although the significant molecular breakthroughs of the 1990s (Fig. 6) and their potential clinical impact is cause for tremendous excitement, this family's genetic mutation underscores the need for ongoing genotype-phenotype investigations(4,28).
We conclude that a novel mutation, ΔF339, in the cardiac potassium channel, KVLQT1, is the molecular basis (LQT1) for this near drowning family's autosomally dominant inherited LQTS. The ΔF339-KVLQT1 mutation segregated with the clinical disease status as predicted phenotypically and by the disease-linked haplotype. The function of this unique mutation has not been elucidated but is believed to disrupt important channel properties such as channel conductance or gating kinetics. Importantly, this potassium channel LQT1 mutation manifests an ECG pattern previously ascribed to the sodium channel-based LQT3 genotype. Although explorations in genotype-phenotype relationships are quite appealing, identification of this novel mutation sounds a cautionary note. Namely, inspection of the LQTS patient's ECG may be insufficient for determining a patient's genotype and therefore, genotype-specific interventions based upon inspection of the ECG should not be made. Ultimately, developments to provide routine clinical molecular diagnostic testing for the inherited long QT syndrome are needed to move the field of LQTS research into the next millennium.
Abbreviations
- KVLQT1:
-
voltage-gated K+ channel gene causing one of the inherited forms of LQTS (LQT1)
- LQTS:
-
long QT syndrome
- QTc:
-
rate-corrected QT interval
- lod:
-
logarithm of odds
References
Ackerman MJ, Clapham DE 1997 Ion channels: basic science and clinical disease. N Engl J Med 336: 1575–1586
Kannel WB, Cupples A, D'Agostino RB 1987 Sudden death risk in overt coronary heart diseases: the Framingham study. Am Heart J 113: 799–804
Willich SN, Levy D, Rocco MB, Tofler GH, Stone PH, Muller JOE 1987 Circadian variation in the incidence of sudden cardiac death in the Framingham heart study population. Am J Cardiol 60: 801–806
Ackerman MJ 1998 The long QT syndrome: ion channel diseases of the heart. Mayo Clin Proc 73: 250–269
Priori SG, Napolitano C, Cantu F, Brown AM, Schwartz PJ 1996 Differential response to Na+ channel blockade, β-adrenergic stimulation, and rapid pacing in a cellular model mimicking the SCN5A and HERG defects present in the long-QT syndrome. Circ Res 78: 1009–1015
Schwartz PJ, Priori SG, Locati EH, Napolitano C, Cantu F, Towbin JA, Keating MT, Hammoude H, Brown AM, Chen LS, Colatsky TJ 1995 Long QT syndrome patients with mutations of the SCN5A and HERG genes have differential responses to Na+ channel blockade and to increases in heart rate. Implications for gene-specific therapy. Circulation 92: 3381–3386
Moss AJ, Zareba W, Benhorin J, Locati EH, Hall WJ, Robinson JL, Schwartz PJ, Towbin JA, Vincent GM, Lehmann MH 1995 ECG T-wave patterns in genetically distinct forms of the hereditary long QT syndrome. Circulation 92: 2929–2934
Ackerman MJ, Porter CJ 1998 Identification of a family with inherited long QT syndrome following a pediatric near drowning. Pediatrics 101: 306–308
Keating M, Atkinson D, Dunn C, Timothy K, Vincent GM, Leppert M 1991 Linkage of a cardiac arrhythmia, the long QT syndrome, and the Harvey ras-1 gene. Science 252: 704–706
Jiang C, Atkinson D, Towbin JA, Splawski I, Lehmann MH, Li H, K. T, Taggart RT, Schwarz PJ, Vincent GM, Moss AJ, Keating MT 1994 Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity. Nat Genet 8: 141–146
Anderson MA, Gusella JK 1984 Use of cyclosporin A in establishing Epstein-Barr virus-transformed human lymphoblastoid cell lines. In Vitro 20: 856–858
Neyroud N, Tesson F, Denjoy I, Leibovici M, Donger C, Barhanin J, Faure S, Gary F, Coumel P, Petit C, Schwartz K, Guicheney P 1997 A novel mutation in the potassium channel gene KVLQT1 causes the Jervell and Lange-Nielsen cardioauditory syndrome. Nat Genet 15: 186–189
Wang Q, Curran ME, Splawski I, Burn TC, Millholland JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating MT 1996 Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet 12: 17–23
Curran ME, Splawski I, Timothy KW, Vincent GM, Green ED, Keating MT 1995 A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell 80: 795–803
Schulze-Bahr E, Wang Q, Wedekind H, Haverkamp W, Chen Q, Sun Y, Rubie C, Hordt M, Towbin JA, Borggrefe M, Assmann G, Qu X, Somberg JC, Breithardt G, Oberti C, Funke H 1997 KCNE1 mutations cause Jervell and Lange-Nielsen syndrome. Nat Genet 17: 267–268
Schott J-J, Charpentier F, Peltier S, Foley P, Drouin E, Bouhour J-B, Donnelly P, Vergnaud G, Bachner L, Moisan J-P, Le Marec H, Pascal O 1995 Mapping of a gene for long QT syndrome to chromosome 4q 25-27. Am J Hum Genet 57: 1114–1122
Lathrop GM, Lalouel J-M, Julier C, Ott J 1985 Multilocus linkage analysis in humans: detection of linkage and estimation of recombination. Am J Hum Genet 37: 482–498
Yang WP, Levesque PC, Little WA, Conder ML, Shalaby FY, Blanar MA 1997 KvLQT1, a voltage-gated potassium channel responsible for human cardiac arrhythmias. Proc Natl Acad Sci USA 94: 4017–4021
Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G 1996 KvLQT1 and IsK (minK) proteins associate to form the IKs cardiac potassium current. Nature 384: 78–80
Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, Keating MT 1996 Coassembly of KvLQT1 and minK (IsK) proteins to form cardiac IKs potassium channel. Nature 384: 80–83
Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta K, Haneda N, Nakano O, Shibata A, Sawayama T, Kasai H, Yazaki Y, Nakamura Y 1997 Four novel KVLQT1 and four novel HERG mutations in familial long-QT syndrome. Circulation 95: 565–567
Russell MW, Dick MI, Collins FS, Grody LC 1996 KVLQT1 mutations in three families with familial or sporadic long QT syndrome. Hum Mol Genet 5: 1319–1324
Saarinen K, Swan H, Kainulainen K, Toivonen L, Viitasalo M, Kontula K 1998 Molecular genetics of the long QT syndrome: two novel mutations of the KVLQT1 gene and phenotypic expression of the mutant gene in a large kindred. Hum Mutat 11: 158–165
Li H, Chen Q, Moss AJ, Robinson J, Goytia V, Perry JC, Vincent GM, Priori SG, Lehmann MH, Denfield SW, Duff D, Kaine S, Shimizu W, Schwartz PJ, Wang Q, Towbin JA 1998 New mutations in the KVLQT1 potassium channel that cause long-QT syndrome. Circulation 97: 1264–1269
Shalaby FY, Levesque PC, Yang WP, Little WA, Conder ML, Jenkins-West T, Blanar MA 1997 Dominant-negative KvLQT1 mutations underlie the LQT1 form of long QT syndrome. Circulation 96: 1733–1736
Vincent GM, Timothy KW, Leppert M, Keating M 1992 The spectrum of symptoms and QT intervals in carriers of the gene for the long-QT syndrome. N Engl J Med 327: 846–852
An RH, Bangalore R, Rosero SZ, Kass RS 1996 Lidocaine block of LQT-3 mutant human Na+ channels. Circ Res 79: 103–108
Ackerman MJ 1998 The long QT syndrome. Pediatr Rev 19: 232–238
Author information
Authors and Affiliations
Additional information
Supported by a Howard W. Siebens Molecular Medicine Fellowship grant awarded to M.J.A.
Rights and permissions
About this article
Cite this article
Ackerman, M., Schroeder, J., Berry, R. et al. A Novel Mutation in KVLQT1 Is the Molecular Basis of Inherited Long QT Syndrome in a Near-Drowning Patient's Family. Pediatr Res 44, 148–153 (1998). https://doi.org/10.1203/00006450-199808000-00002
Received:
Accepted:
Issue Date:
DOI: https://doi.org/10.1203/00006450-199808000-00002
This article is cited by
-
Mutations in Danish patients with long QT syndrome and the identification of a large founder family with p.F29L in KCNH2
BMC Medical Genetics (2014)
-
Telltale hearts
Nature Medicine (2013)