Correction to: Nature Biotechnology https://doi.org/10.1038/nbt.4111, published online 19 March 2018.
In this article, the bottom right panel of Fig. 4a is labeled “TALEsp2 stabilized” and the dashed blue curve in the bottom left panel is identified as the geometric mean of the TALEsp2 stabilized induction curves. In both cases, TALEsp2 should have read TALEsp1. In the Supplementary Information originally posted for this article, the RBSsp2 sequence in Supplementary Table 3 was shown as ATCAATTCATCGACGTGAAA; the correct sequence is ATCAATTCATCGATGTGAAA. This sequence was incorporated into that of the TALEsp2 stabilized promoter used in plasmids pTHSSe_60 and pTHSSf_27-38, 40, 98, and the genomic insertion of pTHSSf_40. The revised Supplementary Information is available in this notice.
Author information
Authors and Affiliations
Corresponding author
Supplementary information
Supplementary Information
Supplementary Figures 1–22, Supplementary Tables 1–3 and Supplementary Notes 1 and 2
Rights and permissions
About this article
Cite this article
Segall-Shapiro, T.H., Sontag, E.D. & Voigt, C.A. Author Correction: Engineered promoters enable constant gene expression at any copy number in bacteria. Nat Biotechnol 40, 799 (2022). https://doi.org/10.1038/s41587-022-01300-7
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41587-022-01300-7