Introduction

Interleukin (IL)-10 is a cytokine that is produced by many cells, among which B cells and monocytes are the primary sources.1 IL-10 was originally described as a cytokine mainly produced by Th2 cells and the function of which was to inhibit the production of pro-inflammatory cytokines (IL-1β, IL-6, IL-8, IL-12 and tumor necrosis factor (TNF)-α).2, 3 IL-10 is also recognized as a pro-inflammatory cytokine that promotes a Th2 response as well as B-cell proliferation and antibody production.4 Following activation, B cells were found to produce high levels of IL-10 in several autoimmune diseases, for example, Sjögren's syndrome, rheumatoid arthritis and systemic lupus erythematosus.5, 6, 7, 8

The main source of B-cell-derived IL-10 is autoreactive B (B-1a) cells.9 Large numbers of B-1a cells were found in subjects with Sjögren's syndrome or rheumatoid arthritis.10, 11, 12 B-1a cells were also detected in gingival lesions of subjects with chronic periodontitis.13 Periodontitis is an infectious disease that affects tooth-supporting structures such as connective tissue attachment and alveolar bone. Findings from epidemiological studies demonstrated that chronic periodontitis is a common disorder and severe forms of the disease occur in 8–10% of adults. Subjects with periodontitis exhibit a larger fraction of circulating autoreactive B cells than healthy individuals.13, 14 Larger proportions of B-1a cells and higher levels of IL-10 were found in the gingival lesions than in peripheral blood.15, 16 In addition, several studies reported on higher levels of antibodies to collagen type 1 in gingival tissue than in serum.17, 18, 19

Several factor-binding sites that might be involved in the regulation of IL-10 were identified in the IL-10 promoter.20, 21, 22 The IL-10 promoter contains several single nucleotide polymorphisms (SNPs) among which the –1087 G/A SNP (sometimes referred to as −1082 G/A) was associated with differences in IL-10 promoter activity and IL-10 production.23, 24, 25, 26, 27, 28, 29 Results of studies on the influence of the –1087 SNP on the IL-10 production in different cell types,23, 25, 26, 27, 28, 29 however, are conflicting. Thus, the presence of an A-allele was shown to result in an increase in the IL-10 promoter activity, which may lead to enhanced production of the IL-10 protein.23 Conversely, other reports suggested that the presence of a G-allele at −1087 was associated with an increase in the IL-10 promoter activity.24, 25, 28, 29

In earlier studies from our laboratory,30, 31 we demonstrated that severe chronic periodontitis was strongly associated with the GG genotype of the −1087 IL-10 gene polymorphism and that the GG genotype correlated with enhanced fractions of IL-10-positive cells in periodontitis lesions.

This study was performed to evaluate the influence of the −1087 SNP on the gene expression of IL-10 and to identify transcription factors binding to this site in B cells. We demonstrated that PU.1 and Spi-B transcription factors bound to the sequence around the −1087 position in the IL-10 promoter region. We also showed that the A to G nucleotide exchange resulted in the binding of Sp1 transcription factor to this site. This nucleotide exchange also resulted in an increase of promoter activity following lipopolysaccharide (LPS) stimulation of B cells.

Results and discussion

The present series of experiments were performed to further elucidate the influence of the A/G nucleotide exchange on the IL-10 promoter activity and to identify transcription factors in B cells that bind to the −1087 position of the IL-10 promoter.

The electrophoretic mobility shift assay (EMSA) analysis resulted in three specific complexes using the 1087G probe and two specific complexes using the 1087A probe. Bands that could not be eliminated by competition with unlabeled probes were considered as corresponding to nonspecific complex formation (Figures 1a and b). The complexes II and III were eliminated by unlabeled 1087G, 1087A and Ets consensus probes and were considered being Ets-related (Figures 1a and b). Competition with an oligonucleotide containing either a mutated Ets site or a nonspecific oligonucleotide (A5/A6) did not eliminate these complexes (Figures 1a and b). Complexes II and III were formed with both alleles but with a less affinity for the 1087G probe as judged by the intensity of the bands (Figures 1a and b). Supershift experiments revealed that Spi-B and PU.1 antibodies shifted complexes II and III, respectively. This confirmed that these factors bound to the −1087 site in both the G- and A-alleles of the IL-10 promoter (Figure 1c). The band identified as complex IV was regarded specific as it was eliminated by 1087G, 1087A mut and Ets consensus probes. Unlabeled 1087G probe was not able to eliminate this band in all experiments. This indicates that complex IV is Ets related. EMSA experiments using the 1087G probe and DG75 nuclear extracts revealed a slow migrating complex referred to as complex I (Figure 1a). Competition experiments showed that complex I was eliminated with unlabeled 1087G probes and probes containing an Sp1 consensus site (Figure 1a). Supershift experiments with two different anti-Sp1 antibodies shifted complex I and, thus, indicated the presence of Sp1 in this complex (Figure 1d).

Figure 1
figure 1

Characterization of factors that bind to the interleukin (IL)-10 promoter region –1087. The first lane shows the binding of 32P-labeled probe 1087G (a) and 1087A (b) with the DG75 nuclear extract. Nuclear extract preparation and the electrophoretic mobility shift assay (EMSA)-binding reaction were performed as described earlier.32 The oligonucleotide 5′–3′ sequences used were: 1087G GCTTCTTTGGGAGGGGGAAGTAGGG,1087A GCTTCTTTGGGAAGGGGAAGTAGGG, 1087A mutated GCTTCTTTGAAGGGGGGAAGTAGGG, Ets consensus GGGCTGCTTGAGGAAGTATAAGAAT, Ets mutated GCTTCTTTGAAGGGGGGAAGTAGGG, A5/A6 containing a mut Sp site GAGGCTTATGTAGTTCGGCTACGTAAGAGTAA, A3/A4 containing an Sp site GAGGCTTATGTAGGGCGGCTACGTAAGAGTAA, Sp1 consensus AT TCGATCGGGGCGGGGCGAGC and C/EBP TGCAGATTGCGCAATCTGCA. Competition experiments were carried out using different oligonucleotides as indicated in the figure. Arrows indicate the position of specific complexes (c). In supershift experiments for PU.1 and Spi-B, 2 μl of the antibody was added after the 20 min incubation of nuclear extract with probe. The samples were then incubated for 60 min at 4 °C. For the supershift experiments with Sp1 antibodies, the samples were incubated for 10 min with the nuclear extract and probe, The antibody (2 μl) was added and the samples were incubated for an additional 10 min at 4 °C. The antibodies PU.1 (sc-352 X), Spi-B (sc-5944 X), Sp1 (sc-59 X, sc-420 X) and C/EBP (sc-150 X) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). The antibody for C/EBP was used as a negative control. The positions of the shifted complexes are shown by arrowheads (c, d).

Full size image

The transfection experiments in Sp1-deficient Drosophila SL2 cells demonstrated that co-transfection with the GCC reporter plasmid and the empty pPacO vector resulted in lower promoter activity than co-transfection with the Sp1 expression vector (Figure 2). Transfection with 0.5 μg of Sp1 expression vector resulted in a sixfold activation for the GCC reporter plasmid, whereas the use of 1 μg of Sp1 vector resulted in a 10-fold activation. For the ACC reporter plasmid, the corresponding fold increase was two and four, respectively. The difference in luciferase reporter activity between the ACC and GCC reporter plasmids was statistically significant when using 1 μg of the Sp1 expression vector (P=0.0043). The increase in transcription for the ACC reporter plasmid may be explained by the binding of Sp1 to a site further downstream at position −571.33 This binding site is present in both reporter plasmids, GCC and ACC.

Figure 2
figure 2

Sp1 increases promoter activity of interleukin (IL)-10 more efficiently in the GCC haplotype as compared to the ACC haplotype. The pGL4 luciferase reporter plasmids (Promega Corp., Madison, WI, USA) containing the DNA sequence –1111 to +1 bp (numbering is relative to the transcription start site) from the human IL-10 promoter were a kind gift from Dr Karen E Hedin.29 The two reporter plasmids are referred to as ACC and GCC as defined by the G or A nucleotide at the –1082, C at the –819 and C at the –592 position. The pPacSp1 expression vector and the pPac0 vector were kindly provided by G Suske (Klinikum der Philipps-Universität Marburg, Marburg, Germany). The Drosophila SL2 cells were grown at 28 °C in Schneider's Drosophila medium (Gibco BLR, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (Sigma Chemical Co., St Louis, MO, USA), 100 U penicillin ml−1 and 100 μg streptomycin ml−1. Increasing amount of Sp1 expression vector, compensated with the appropriate amount of empty vector, was co-transfected with IL-10 reporter plasmids into SL2 cells. The SL2 cells were transfected using the Lipofectamine LTX kit (Invitrogen corp., Carlsbad, CA, USA) according to the manufacturer's instructions. Briefly, on the day before the transfection, 0.187 × 106 cells per well were seeded in six-well dishes. The GCC or ACC luciferase reporter plasmids (2 μg) were co-transfected with 0.5–1 μg of Sp1 expression vector (pPacSp1). The total amount of DNA was made up to 2 μg by compensating with the empty vector pPac0. Luciferase activity was measured 72 h after transfection. The relative luciferase activity of each variant in the absence of Sp1 expression vector was set to 1. The values are the means of three independent transfections. Differences in luciferase reporter activity were analyzed using the analysis of variance (ANOVA), the Student's t-test and the Student–Newman–Keuls test. P-values <0.05 were considered significant. Bars indicate standard error of the means.

Full size image

DG75 B cells were transfected with the GCC and ACC reporter plasmids and subsequently incubated with or without LPS. After 24 h of LPS stimulation, the cells that were transfected with the GCC reporter plasmid showed a 15-fold increase in activity, whereas the cells that were not treated with LPS showed only a 5-fold activation. For cells transfected with the ACC reporter plasmid, the fold activation was sixfold for the stimulated cells and threefold for the unstimulated cells (Figure 3). This finding indicates that the Sp1 binding to the −1087 position induces the large increase in promoter activity. In earlier studies, LPS has been shown to activate IL-10 gene expression through Sp1.34, 35 Brightbill et al.35 showed that transfection of a murine macrophage cell line with the IL-10 promoter construct resulted in an eightfold increase on LPS stimulation. These results are in line with the results presented in the current study.

Figure 3
figure 3

Effect of LPS stimulation on the activity of interleukin (IL)-10 reporter plasmids ACC and GCC. The DG75 B cells were maintained as a suspension culture in RPMI-1640 medium (Sigma Chemical Co., St Louis, MO, USA) supplemented with 10% fetal bovine serum (Sigma), 100 U penicillin ml−1 and 100 μg streptomycin ml−1. Transient transfections of DG75 were performed using 5 × 106 cells and 10 μg DNA of reporter plasmids ACC, GCC or pGL4 plasmid by electroporation at 260 V and 960 μF in 250 μl cell culture medium in 4-mm cuvettes (Bio-Rad laboratories AB, Uppsala, Sweden) with the Bio-Rad Gene Pulser.32 In some experiments, 10 μg ml−1 lipopolysaccaride (LPS) from E. coli (Sigma) was added to the cells 4 h after the transfections. The cells were harvested after 24 h and assayed for luciferase activity using the Luciferase Assay System (Promega Corp.) according to the manufacturer's instructions. A Glomax 20/20 Luminometer (Turner BioSystem Inc., Sunnyvale, CA, USA) was used for the detection of luciferase activity. The relative luciferase activity of pGL4 was set to 1. The values are the means of three transfections done in duplicates. Differences in luciferase reporter activity were analyzed using the analysis of variance (ANOVA), the Student's t-test and the Student–Newman–Keuls test. P-values <0.05 were considered significant. Bars indicate standard error of the means.

Full size image

Different polymorphisms, including the −1087 A/G polymorphism, in the IL-10 promoter are proposed to influence the promoter activity and, hence, the IL-10 production.25, 28 Transcriptional regulation of the IL-10 gene was studied in several cell types,23, 24, 29, 33 but the results regarding the influence of the −1087 polymorphism on IL-10 gene expression are conflicting. Rees et al.23 using transient transfections in an Epstein–Barr virus-transformed human B-cell line showed that the A-allele was associated with a twofold increase in transcriptional activity as compared to the G-allele. Opposite findings were presented by Reuss et al.,24 who stated that both the ACC and ATA promoter constructs were associated with a significant decrease in transcriptional activity as compared to GCC using the monocytic cell line THP1. The authors suggested that PU.1 inhibits gene expression of IL-10 by binding to the −1087 site. This notion was supported by data presented by Borràs et al.36 However, other data suggested that both PU.1 and Spi-B upregulate gene expression.37

To our knowledge, this is the first time that Sp1 has been shown to bind at the −1087 position in the human IL-10 promoter. The results of the EMSAs in the present study indicated that Sp1 has a higher affinity for this site than PU.1 and Spi-B. It is therefore suggested that Sp1 rather than PU.1 and Spi-B is the dominant regulator of promoter activity for the GCC haplotype of the IL-10 promoter through this site.

Studies have shown that the Sp1 transcription factor is important in the regulation of IL-10 transcription.35, 38, 39 The mechanism of LPS stimulation involves the binding to proteins, presentation to the cell surface receptor CD14 and subsequently the toll-like receptor 4 (TLR4).40 LPS-induced activation of Sp1 in turn regulates the transcription of the human IL-10 gene.35, 38, 39, 41

In conclusion, this study demonstrated that the transcription factors PU.1, Spi-B and Sp1 in B cells bound to the −1087 site in the IL-10 promoter region. Using transfection of the DG75 B-cell line, we showed differences in promoter activity for the ACC and GCC haplotypes. In addition, stimulation of B cells with LPS, which is known to induce promoter activity through Sp1-binding sites, increases the activity of the −1087 G-allele in the IL-10 promoter. Further studies using chromatin immunoprecipitation assay are intended to study the binding of Sp1 and the influence of LPS in B cells.