Abstract
Homeodomain-leucine zippers (HD-Zip) are plant-specific transcription factors that participate in different plant development processes and differentially regulate metabolic processes. LoHDZ2 is an HD-ZipII subfamily transcription factor gene that we identified from a transcriptomic analysis of Larix olgensis. To understand its function, we built a LoHDZ2 expression vector and then inserted it into tobacco by genetic transformation. Transgenic plants were identified at the DNA and RNA levels. Phenotypic index analysis of transgenic tobacco showed dwarfed growth with larger leaves and earlier flowering than the wild type. LoHDZ2 was expressed differently after hormone treatment with IAA, MeJA and 2,4-D. The results suggested that LoHDZ2 may respond to hormones and be involved in regulating growth and metabolism. These results helped us better understand the function of LoHDZ2 and provided a candidate gene for Larix olgensis molecular breeding.
Similar content being viewed by others
Introduction
The development and growth of plants is controlled by genes, the external environment and internal physiology1. Unsuitable Environmental conditions for the growth of plant usually result in stress. Stress in plants is mainly divided into biotic stress and abiotic stress. Abiotic stresses during plant growth, such as salt stress, drought stress, and cold stress, are universal in nature2.
HD-Zip transcription factors are plant-specific transcription factors. They belong to the homeobox protein family and have a highly conserved HD (homeodomain)3. Based on the characteristics of sequence conservation, genetic structure and physiological function, HD-Zip transcription factors can be separated four subfamilies, such as HD-ZipI, HD-ZipII, HD-ZipIII and HD-ZipIV4. Different subfamilies have differences in their genetic composition and the structure of their encoded proteins. Therefore, these transcription factors participate in different plant development processes and differentially regulate metabolic processes. According to previous study, Tril (trichome-less) encodes an HD-ZipIV transcription factor plays a significant role in the primary growth of trichomes and fruit spines5. HD-ZipII transcription factors may regulate plant development through growth protein pathways6.Overexpression of ECHB1 inhibited defoliation and thus improved growth of eucalyptus under drought stress, reducing water loss from trees by reducing leaf area, but not changing stomatal morphology7. HD-ZipII transcription factors affect rice plant development through modulating gibberellin biosynthesis8.
Larix olgensis is an important coniferous species in China. It has a straight, high-quality and durable trunk9. In this study, 50 mg · L−1 GA3, IAA, ABA, 6-BA, MeJA or 2,4-D solutions or water (control) was sprayed on larch seedlings prior to extracting RNA, which was reverse transcribed into cDNA. Using qRT-PCR to analyzed the expression level of LoHDZ2. Additionally, the coding region of LoHDZ2 was cloned using the leaf-disk method and Agrobacterium, resulting in LoHDZ2 overexpression in transgenic tobacco. Afterwards, the phenotypic changes were measured, and the expression level of LoHDZ2 in transgenic tobacco under different treatments was analyzed. According to the above research, LoHDZ2 plays a role in the growth of Larix olgensis.
Materials and methods
Plant materials and growth conditions
Plant materials are collected and cultivated in accordance with relevant national and international legislation and guidelines, and the cultivation method is carried out under the guidance of professors.
Full and glossy Larix olgensis seeds were selected and then sown in a vegetative soil substrate with a 5:3:2 ratio of clear soil:vermiculite:perlite. The conditions were 8 h dark culture and 16 h light culture, 75% humidity, and the temperature is 22 °C.
The tobacco used in this experiment came from the Forest Genetics and Breeding Laboratory of Northeast Forestry University. Collect and use in accordance with relevant national and international regulations and guidelines. First, the seeds were soaked in 20% sodium hypochlorite for 15–20 min, washed with aseptic water 6–7 times, and then inoculated on MS solid medium to germinate, such that sterile seedlings were obtained10. Tissue culture seedlings with good growth were selected for propagation as receptor materials for genetic transformation.
Quantitative real-time PCR analysis
Young larch seedlings that had been growing healthy and strong for 30 days were transplanted into a seedling pot and cultured in a nutrient soil matrix for 2–3 months. Then, larch seedlings were sprayed with 50 mg · L−1 GA3, IAA, ABA, 6-BA, MeJA or 2,4-D solution or water (as a control), and whole larch seedlings were collected after treatment at 0 h, 2 h, 4 h, 8 h, 12 h, 24 h, 48 h, 72 h and 96 h11. RNA was extracted and reverse transcribed into cDNA for qRT-PCR.
Primer5 software was used to design quantitative primers (LoHDZ2-RT-F: CTTGGCGTTGGTGTGTCTATG; LoHDZ2-RT-R: TGGGCATGAACCAAAGAAAC). Using an ABI7500 fluorescent qRT-PCR instrument, the dissolution curve was determined according to standard procedures, with the following reaction procedure: 94 °C for 30 s, followed by 40–45 cycles of 94 °C for 5 s, 58 °C for 15 s, and 72 °C for 10 s. The differences in the three CT values were all less than 1. Microsoft Excel 2016 was used for data analysis, and GraphPad Prism5 software was used for graphing; the internal reference gene of Larix olgensis is MF278617 on NCBI. The expression of LoHDZ2 under different treatments was analyzed based on the qRT-PCR results.
Plasmid construction
According to the reference LoHDZ2 (gene number is MW206675 on NCBI) gene sequence, specific primers were designed to amplify vector fragments: LoHDZ2-BamHI-F: GGATCCATGGAAGAGATGAAGAACAAGCA; LoHDZ2-Xbal-R: TCTAGATTAGCAAGCTGCAGACTGTTGG. The PCR system contained 1 µl of template, 1.5 µl each of the upstream and downstream primers, 25 µl of KOD FX PCR buffer, 10 µl of dNTPs, 1 µl of KOD FX, and ddH2O to a final volume of 50 µl. The reaction conditions were as follows: 94 °C for 2 min; 40 cycles of 98 °C for 30 s and 68 °C for 1.5 min; and 68 °C for 10 min.
After the reaction, the PCR products were subjected to agarose gel electrophoresis, and recovery of target fragment by a gel recovery kit. The restriction enzymes BamHI and Xbal were used to insert the product into the plant expression vector pCAMBIA1302 (Fig. 1). Using T4 ligase to connect the product and vector., then the vectors were inserted into E. coli DH5α cells that were then grown on LB medium containing kanamycin at 37 °C for 12 h to 16 h. PCR was performed to confirm vector uptake by the bacteria.
The positive transformants were sent to Kumei Biotechnology Company for sequencing, and the sequencing reaction was preserved for plasmid extraction. The plasmid p1302-LoHDZ2 was transferred into Agrobacterium tumefaciens GV3101 competent cells by the liquid nitrogen freeze–thaw method, and PCR was performed for detection, with preservation of the bacterial solution.
Transient expression of GFP in tobacco by injection
Based on the designed primer sequence of LoHDZ2 CDs sequence, the enzyme digestion sites of Xbal and Spel required by VB191104-eGFP vector were added, and the termination codon TAA at the 3 'end of the downstream primer was removed: LoHDZ2-Xbal-F: TCTAGAATGGAAGAGATGAAGAACAAGCA; LoHDZ2-Spel-R: ACTAGTAGCAAGCTGCAGACTGTTGG. The plasmid of p1302-LoHDZ2 was used as template and VB191104-eGFP-LoHDZ2-S/A was used as primer for PCR amplification. The PCR product was detected by electrophoresis with 1.2% agarose gel. Then recovered the target strip and the gel. The product was named VB191104-LoHDZ2-eGFP.
Then the restriction enzymes Xbal and Spel were used to insert the product into the plant expression vector VB191104-eGFP, then T4 ligation was performed and transformed into E. coli DH5α cells competent state,the method is the same as “Plasmid construction”. The positive transformants were sent to Kumei Biotechnology Company for sequencing, and the sequencing reaction was preserved for plasmid extraction. The plasmid VB191104-LoHDZ2-eGFP was transferred into Agrobacterium tumefaciens GV3101 competent cells by the liquid nitrogen freeze–thaw method.
We injected into tobacco leaves with Agrobacterium VB191104-LoHDZ2-eGFP as control 2 ~ 5 days after injection, GFP fluorescence signal was detected under portable long wavelength UV lamp, and GFP signal was detected by fluorescence microscope or laser copolymerization fluorescence microscope.
Antibiotic susceptibility test
As the overexpression vector used in this study was a modified vector from our laboratory, it was necessary to screen the tobacco plants for sensitivity to hyg. Hygromycin can produce an obvious phenotype in a relatively short amount of time at low concentrations and has a large degree of toxicity to the recipient material, so screening is easily performed12.
In this study, wild-type tobacco seeds were selected and disinfected with a 20% bleach solution in water and then washed 5–6 times with sterile water. Seeds were inoculated on 1/2 MS growth medium containing 0, 15, 20, 25, 30 and 35 mg · L−1 hyg for one week; then, their growth was observed, and the optimal concentration of hyg was selected.
Genetic transformation and verification of transgenic plants
The genetic transformation of tobacco was carried out according to the leaf-disk genetic transformation system13. After 23 d of coculture in medium with 25 mg · L−1 hygromycin and 250 mg · L−1 cephalosporin, cultivation was performed for approximately 3 weeks to induce stem growth, and seedlings were transferred to rooting medium. Extracted the DNA of resistant plants’ leaves and detected using the pCAMBIA1302 vector primers via PCR. The PCR product was subjected to 1.2% agarose gel electrophoresis to screen for positive T1 seeds. The seeds of the T1 generation were cultured on the resistance medium and planted in the vegetative soil matrix after seed germination, and after flowering, plants from the T2 generation were determine to be transgenic plants.
The total RNA of different transgenic, T2 generation tobacco lines and wild tobacco was extracted after 30 days, and reverse transcribed cDNA was used as a template. Then, qRT-PCR was performed by using quantitative gene primers. The detection and calculation methods were the same as in Sect. 2.2.
Growth index
Twenty samples of the OE2, OE4 and OE5 transgenic plants and wild-type tobacco were propagated and transplanted to nutritional soil matrix. The plants were cultured under long days in an artificial climate culture chamber, and photographs of transgenic and wild-type tobacco at different time periods (in transplanting to soil at 30 d, 60 d and 90 d) were collected to measure plant height, leaf width and leaf length based at least 20 seedlings. Microsoft Excel 2016 statistical software was used to analyze the data, and GraphPad Prism 5 software was used to generate figures.
The above experimental analysis included at least three biological replicates. At the same time, calculating the change of plant height, leaf height and leaf width of the three transgenic lines and wild-type tobacco, the formula (a-b)/a*100% (a: plant height in the previous period; b: plant height in the later period) was used14.
Determination of physiological indexes under hormone treatment
A solution containing 50 mg·L−1 IAA, MeJA and 2,4-D was sprayed on plants from three transgenic lines and wild-type tobacco, and three mixed samples were selected from each line after treatment for 0 h, 12 h, 24 h, 48 h and 96 h. The total RNA of the mixed samples was extracted and reverse-transcribed into cDNA for qRT-PCR.
Results
qRT-PCR of LoHDZ2 under different hormone treatments
After Larix olgensis seedlings were treated with 50 mg·L−1 GA3, IAA, ABA, 6-BA, MeJA, or 2,4-D solutions or water (control), according to the qRT-PCR results(Fig. 2, and see Supplementary information), it showed that the expression of LoHDZ2 was downregulated sixfold after treatment for 96 h with 6-BA. However, the expression was upregulated during 0–72 h of treatment. The expression of LoHDZ2 was downregulated fivefold from 4 to 96 h after ABA treatment. The expression of LoHDZ2 was upregulated within 96 h after IAA, 2,4-D and MeJA treatment.
Plasmid construction
The total length of the LoHDZ2 was 945 bp; it encoded a protein with 314 amino acids and a molecular weight of 36.89 kDa15. LoHDZ2 belongs to the HD-ZipII subfamily. The total RNA of Larix olgensis was extracted with an RNA extraction kit and reverse transcribed into cDNA. This gene was then amplified with cDNA as the template, and then the restriction enzymes XbaI and BamHI were used to double digest the pCAMBIA1302 vector (Fig. 3). After ligation with T4 ligase, the vector which was temporarily named p1302-LoHDZ2, was inserted into E. coli DH5α cells. A random colony containing the pCAMBIA1302 vector was selected for confirmation with universal and gene-specific primers via PCR. The positive plasmid sequencing results showed that LoHDZ2 was present in the pCAMBIA1302 vector, there were no amino acid mutations, and creation of the p1302-LoHDZ2 vector was successful (Fig. 4).
Transient expression of GFP in tobacco by injection
The VB191104-LoHDZ2-eGFP vector was successfully constructed, and the OD value of Agrobacterium tumetobacter was adjusted to 0.6. The tobacco leaves were injected with the infection solution, and the GFP signal was detected by fluorescence microscope or laser co-fluorescence microscope.
Based on the results of the experiment, LoHDZ2-eGFP can only detect the green fluorescent signal expressed by GFP in the nucleus, while the signal of GFP in the control group can be detected in the whole cell (Fig. 5). The above experimental results indicate that LoHDZ2-eGFP is located in the nucleus.The subcellular localization results are consistent with the basic feature that most transcription factors are located in the nucleus.
Antibiotic susceptibility results
Resistance screening was performed in culture medium with different concentrations of hyg. Hyg influenced tobacco seed germination and growth after a week of culture in medium containing different concentrations of hyg (Fig. 6). In the medium containing 25, 30 and 35 mg·L−1 hyg, embryonic callus growth was restrained and presented a blade-yellowing phenomenon. We found that 25 mg·L−1 hyg was suitable for screening tobacco genetic transformants.
Genetic transformation and detection of the p1302-LoHDZ2 vector in tobacco
The leaf-disk transformation method was adopted, and Agrobacterium tumefaciens GV3101 (p1302-LoHDZ2) was used to infect tobacco leaves. The transgenic leaves were screened for resistance (Fig. 7a). After the resistant buds were isolated, they were subcultured on differentiation medium containing hyg antibiotics, and budding buds were obtained (Fig. 7b).
After the tufted buds emerged from the stems, plants were transplanting to root culture medium (Fig. 7c); after rooting, plants were transplanted to nutritional soil for cultivation(Fig. 7d).After screening for T1 and T2 generations, then cultured resistant plant; their growth phenotypes were observed. DNA was extracted from seven lines of transgenic tobacco and wild-type tobacco, and vector-specific and gene-specific primers were used for PCR detection (Fig. 8, and see Supplementary information). qRT-PCR of LoHDZ2 was performed for four transgenic plants, and the relative expression was quantified in wild-type tobacco (Fig. 9).
The results showed that LoHDZ2 was expressed in all four lines, and the relative expression level was high in OE2, OE4 and OE5. The three transgenic lines OE2, OE4 and OE5 were used in subsequent experiments.
Phenotypic changes and growth indexes of transgenic tobacco
Phenotype determination of transgenic tobacco
OE2, OE4 and OE5 were selected for character determination because of their high level of gene expression. Transgenic lines and wild-type plants were transplanted to the soil, and once plants grew true leaves, plant height was observed at different times (30 d, 60 d and 90 d) (Fig. 10). The morphological changes in wild-type tobacco after 30 d of cultivation in the greenhouse were compared with those of transgenic tobacco. We found that transgenic tobacco grew slower and shorter, demonstrating a dwarfing phenomenon. After 60 days of growth, the plant height of the three transgenic plants was shorter and the leaves were smaller than those of the wild-type tobacco seedlings. After 90 days of growth, the plant height of the three transgenic tobacco lines was still shorter than that of the wild-type tobacco, but the leaves were relatively larger.
The transgenic plants entered the anthesis stage after 3 months of growth (Fig. 11e, and see Supplementary information), which was approximately 7–10 days earlier than wild-type tobacco. Compared with wild-type tobacco, the petals, sepals and ovary growth and color of transgenic tobacco were different; transgenic plants showed a paler corolla color, early maturity (Fig. 11a,c,d, and see Supplementary information), deeper stigma and style colors, and atrophied petals. However, the fruit development of transgenic plants was normal (Fig. 11b, and see Supplementary information), and ovules full of seeds were well developed with normal coloration in the three transgenic lines.
Determination of the growth index of transgenic tobacco
We measured plant height, leaf length and leaf width in LoHDZ2-OE transgenic tobacco and wild-type tobacco grown for 30 d, 60 d and 90 d (see Supplementary information). In addition, the changes in plant high, leaf length and leaf width were calculated, and the statistical results showed that the three transgenic tobacco lines were shorter than the wild-type plants across the different growth periods; however, there was no significant difference among the three transgenic lines. The wild-type tobacco and transgenic tobacco plants from the three lines all reached their maximum growth rate in terms of plant height at 60 days (Fig. 12a). From then on, the plant growth rate slowed down. However, the growth rates of LoHDZ2-OE2, LoHDZ2-OE4 and LoHDZ2-OE5 at 60 days were higher than that of wild-type tobacco (Fig. 12b).
The results showed that the leaf width of wild-type tobacco at 30 days was signally higher than that of the three lines of transgenic tobacco. At 60 days, the leaf width of transgenic tobacco was still smaller than that of wild-type tobacco, but the difference was not significant. After 90 days of growth, the difference in the leaf widths of transgenic and wild-type tobacco was relatively small, with little difference across the three transgenic lines (Fig. 12c). The results show that the leaf growth rate of transgenic plants was higher than that of wild-type plants within 60 days of plant growth. Additionally, after 60 days of plant growth, the transgenic plants had the highest rate of leaf growth, while the wild-type tobacco had the lowest rate of leaf growth. At 90 days of plant growth, the leaf growth rate of wild-type tobacco was higher than that of transgenic plants (Fig. 12d).
After 30 days of growth, the leaf length of wild-type tobacco was obviously higher than that of transgenic tobacco. However, at 60 days and 90 days of growth, the leaf length of transgenic plants was alike to that of wild-type plants (Fig. 12e). At 60 days of growth, the leaf length growth rate of transgenic plants was significantly higher than that of wild-type plants. After 60 days, the leaf length growth rate decreased obviously (Fig. 12f).
Relative expression levels of transgenic plants under different hormone treatments
Compared to the expression of LoHDZ2 in untreated wild-type Larix olgensis, the expression of LoHDZ2 was upregulated in the plants treated with the three hormones for 96 h, so the transgenic tobacco plants were then treated with the three hormones to examine their differential gene expression. The transgenic and wild-type tobacco plants were sprayed with 50 mg · L-1 IAA, 2,4-D and MeJA solutions for 0 h, 12 h, 24 h, 48 h and 96 h. Then, qRT-PCR was used to determine the relative expression level under different treatments (Fig. 13).
Compared with wild-type plants, transgenic plants showed wilting 48 h after 2,4-D hormone treatment (Fig. 13a). The relative expression of LoHDZ2 in different transgenic lines of tobacco changed over time under the 2,4-D hormone treatment. When the plants were treated with 2,4-D hormone for 0 h, the expression of LoHDZ2 in the three transgenic lines was about 4 times lower than that of wild-type plants. After treatment for 12 h and 24 h, the expression of LoHDZ2 in all three transgenic lines was about 7–8 times higher than that of wild-type tobacco. After treatment for 48 h and 96 h, the expression of LoHDZ2 in three transgenic strain was 8 to 9 times lower than that in the wild-type tobacco. The data show that across all 2,4-D hormone treatments, the expression levels of LoHDZ2 in the three transgenic lines were not significantly different (Fig. 13b).
It can be seen that the transgenic seedlings after MeJA treatment for 96 h were in good condition (Fig. 13c). After treatment with MeJA (Fig. 13d), the expression levels of transgenic plants were different from the wild-type tobacco. After treatment with MeJA for 0 h, the expression of LoHDZ2 in the three transgenic lines was approximately 4 times lower than that in the wild-type tobacco. After 12 h of treatment, the expression of LoHDZ2 in all three transgenic lines was approximately 3 times lower than that of wild-type tobacco. After 24 h and 48 h of MeJA treatment, the expression of LoHDZ2 in the three transgenic lines was approximately 7–8 times lower than that of wild-type tobacco, and there was little difference between the LoHDZ2-OE2 and LoHDZ2-OE4 plants. After 96 h, the expression of LoHDZ2 in the three transgenic lines was approximately 6 to 7 times higher than that in wild-type tobacco, but compared with the expression at 24 h and 48 h, the level was lower.
The transgenic seedlings grew well after IAA hormone treatment for 48 and 96 h (Fig. 13f). It can be seen that after IAA hormone treatment, the relative expression of LoHDZ2-OE2 and LoHDZ2-OE4 plants were differed. After treatment with IAA for 0 h, the expression of LoHDZ2 in the three transgenic lines was approximately 4 times lower than that in the wild-type tobacco. After treatment for 12 h, the expression of LoHDZ2 in all three transgenic lines was approximately 7–9 times lower than that of wild-type tobacco, and the expression of LoHDZ2 in LoHDZ2-OE5 was the lowest, which was approximately 9 times than that of wild-type tobacco. After treatment for 24 h, the expression of LoHDZ2 in the three transgenic lines was approximately 7–8 times lower than that in the wild-type tobacco, and the expression of LoHDZ2 in LoHDZ2-OE4 was lower than that in LoHDZ2-OE5. After treatment for 48 h, the expression of LoHDZ2 in the three transgenic lines was approximately 6–9 times higher than that in the wild-type tobacco, and the expression of LoHDZ2 in LoHDZ2-OE2 and LoHDZ2-OE4 was still lower than that in LoHDZ2-OE5. After 96 h, the expression of LoHDZ2 in the three transgenic lines was approximately 4–5 times higher than that of wild-type tobacco, and the expression level was lower than that after 48 h of treatment (Fig. 13f).
Discussion
Based on the available data, no studies have reported on the function of HD-Zip family genes in Larix olgensis. Some Arabidopsis homeodomain leucine zipper (HD-zip) transcription factors are thought to rapidly induce responses to changing environmental conditions and integrate hormone signals16. The gene encoding the HD-Zip protein is highly conserved in evolution and has also been identified in basal plant species17,18. Another commonality among HD-Zip proteins is that their recognition of pseudopalindromic cis-elements, which has been notarized in DNA-binding studies.
The transcription HD-ZipII factors are known to play an important role in shade avoidance. Several members of the HD-ZipII transcription factors have been shown, they play an pivotal role in responses to shade19. In contrast to Arabidopsis HD-ZipI proteins composed of homologous domains fused to the leucine zipper domain, most HD-ZipII proteins contain an amphiphilic inhibitory motif associated with an amino-terminal ethylene reactive element binding factor(EAR‐domain). The EAR domain containing the protein is commonly used as a transcriptional suppressor20.
LoHDZ2 belongs to the HD-ZipII transcription factor family. In previous studies, we preliminarily analyzed the expression of three genes (LoHDZ2, LoHDZ11 and LoHDZ13) and found that their expression is the highest in nonlignified roots, indicating that they might be related to the growth of Larix olgensis15. First, we chose six plant hormones to treat Larix olgensis, and we used qRT-PCR to analyze the expression of LoHDZ2 under different treatments of different time. We found that within 96 h of treatment with 2,4-D, IAA and MeJA, the expression of LoHDZ2 was upregulated, it indicated that this gene was responsive to all three hormones. We hypothesized that this gene might be involved in plant growth.
Afterwards, in order to determine the function of LoHDZ2, we cloned LoHDZ2 and inserted it into tobacco by genetic transformation. The phenotype of transgenic tobacco was determined, and the transgenic plants were subjected to stress and qRT-PCR detection. The results showed that the transgenic plants showed a dwarf phenotype, but the growth rate of transgenic seedlings was higher than that of wild-type tobacco.But the plant dwarfing may be affected by the CaMV35S promoter in the vector, because low expression or silencing of genes driven by CaMV35S promoter was found in chrysanthemum21. However, it is also possible that HD-ZipII subfamily transcription factor genes inhibit the expression of a downstream regulatory gene. Studies have shown that the interacting transcription factors in this family have been duplicated multiple times to modulate gene expression across diverse processes, including hormone signaling, stress responses, and the control of flowering time, for which we also found similar results22.
Additionally, at 60 days of plant growth, both the seedling height and leaf growth rate of transgenic plants reached the maximum. The transgenic plants bloomed a week earlier than the wild-type plants, but the growth and ripening of seeds was not affected. It can be seen that transgenic plants might put more energy into reproductive growth rather than vegetative growth. According to existing studies, Ciarbelli found that induction of HD-ZipII and increased levels of the plant hormone auxin seem to be essential for complete shade avoidance23, which was similar to our results.
Plant growth and development are regulated by nutrient endogenous hormones and the growth environment. Plant hormones are involved in almost every process regulating plant growth and development. Plants must adapt to the external environment in order to survive. After IAA and 2,4-D treatment, LoHDZ2 showed higher expression within 12 to 24 h, but after 48 h of treatment, it showed lower expression. As is known, growth hormones within a certain concentration range can promote plant growth, but beyond this range, these hormones can inhibit the growth of plants. It was found that the auxin synthesis and transport of hat3 and athb4 double mutants were affected24 REV transcription induces genes encoding growth protein biosynthetase25, it points to signal integration at the level of hormone signaling. The results of this study suggested that LoHDZ2 may be involved in the regulation of metabolism, as well as the transport and regulation of plant growth hormones, which further suggested that LoHDZ2 may be involved in promoting plant reproductive growth and inhibiting plant vegetative growth.
MeJA plays an crucial role in the regulation of plant growth and development. MeJA can inhibit root growth26, seed germination and tuber induction27, the formation of trichomes, and the development of flowers, pollen sacs, and pistils, as well as pollen sac cleavage and filament elongation28. MeJA plays an important part in the stress response of plants. After 24 h of treatment with MeJA hormone the expression of LoHDZ2 was significantly upregulated, but the plant wilting rate was faster than that of wild-type tobacco. Therefore, it was speculated that LoHDZ2 might inhibit the expression of downstream stress-related genes. The specific function of LoHDZ2 still needs to be further studied. Our research on the function of LoHDZ2 is still ongoing.
Data availability
All data is the original data of the experiment, and the original drawing data is contained in a separate folder.
Abbreviations
- 2,4-D:
-
2,4-Dichlorophenoxyacetic acid
- 6-BA:
-
6-Benzylaminopurinehydrochloride
- ABA:
-
Applied behavior analysis
- Bp:
-
Base pair(s)
- cDNA:
-
DNA complementary to RNA
- d:
-
Day
- dNTP:
-
Deoxyribonucleoside triphosphate
- GA3 :
-
Gibberellin
- Hyg:
-
Hygromycin
- IAA:
-
Indole-3-acetic acid
- kDa:
-
Kilodalton(s)
- IL:
-
Interleukin
- LB:
-
Luria–Bertani (medium)
- Lo:
-
Larix olgensis
- MeJA:
-
Jasmonic acid methylester
- MS:
-
MS Medium
- Min:
-
Minutes
- OE:
-
Over expression
- qRT-PCR:
-
RealtimeQuantitativePCR
References
Xiao, X. et al. Transcriptome analysis reveals the different response to toxic stress in rootstock grafted and non-grafted cucumber seedlings. Int. J. Mol. Sci. 21, 3 (2020).
Lu, Y. The molecular mechanism of plant hormone ABSCISIC ACID regulates suberin biosynthesis in arabidopsis thalana. 2015.
Jiang, K. & Asami, T. Chemical regulators of plant hormones and their applications in basic research and agriculture. Biosci. Biotechnol. Biochem. 82(8), 1265–1300 (2018).
Tang, X., et al. A single transcript CRISPR-Cas9 system for multiplex genome editing in plants, 2019. p. 75–82.
Xue, W. et al. Experimental study on soil fire temperature field of harvested site of Larix olgensis plantation. J. Appl. Ecol. 30(3), 785–792 (2019).
He, G. et al. The HD-ZIP II transcription factors regulate plant architecture through the auxin pathway. Int. J. Mol. Sci. 21, 9 (2020).
Sasaki, K. et al. Overexpressing the HD-Zip class II transcription factor EcHB1 from Eucalyptus camaldulensis increased the leaf photosynthesis and drought tolerance of Eucalyptus. Sci. Rep. 9(1), 14121 (2019).
Chen, W. et al. Small Grain and Dwarf 2, encoding an HD-Zip II family transcription factor, regulates plant development by modulating gibberellin biosynthesis in rice. Plant Sci. 288, 110208 (2019).
Zhang, L., Zhang, H. & Pang, Q. Physiological evaluation of the responses of Larix olgensis families to drought stress and proteomic analysis of the superior family. Genet. Mol. Res. GMR 14(4), 15577–15586 (2015).
Zhang, S. Z. et al. Genetic transformation of tobacco with the trehalose synthase gene from Grifola frondosa Fr enhances the resistance to drought and salt in Tobacco. J. Integr. Plant Biol. 47(5), 579–587 (2005).
Li, D. et al. Analysis of the expression of soybean Gm WRI1 gene under sugar, phytohormone and salt stress. Crops 2, 2 (2015).
Pullman, G. et al. Improved Norway spruce somatic embryo development through the use of abscisic acid combined with activated carbon. Plant Cell Rep. 24(5), 271–279 (2005).
Liu, Y. et al. Construction of plant expression vector and genetic transformation analysis of Arabidopsis thaliana AtPAP1 gene in Nicotiana tabacum. Plant Physiol. Commun. 053(007), 1199–1207 (2017).
Yan, et al. Effects of salt stress on growth and physiological characteristics in dryland wheat seedlings. Adv. J. Food Sci. Technol. 2, 2 (2016).
An, P. et al. Spatiotemporal expression and bioinformatic analyses of the HD-zip transcription factor family in Larix olgensis. Plant Mol. Biol. Rep. 2, 1–14 (2020).
Brandt, R. et al. Homeodomain leucine-zipper proteins and their role in synchronizing growth and development with the environment. J. Integr. Plant Biol. 56(6), 518–526 (2014).
Floyd, A. et al. Evolution of class ill homeodomain-leucine zipper genes in streptophytes. Genetics 2, 2 (2006).
Floyd, S. K. & Bowman, J. L. Distinct developmental mechanisms reflect the independent origins of leaves in vascular plants. Curr. Biol. 16(19), 1911–1917 (2006).
Brandt, R. et al. Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses. Plant J. 72(1), 31–42 (2012).
Kagale, S. & Rozwadowski, L. K. Genome-wide analysis of ethylene-responsive element binding factor-associated amphiphilic repression motif-containing transcriptional regulators in Arabidopsis. Plant Physiol 152(3), 1109–1134 (2010).
Yang, S. et al. Expression analysis of CaMV 35S promoting GUS exogenous genes in transgenic chrysanthemum. J. Nanjing Agric. Univ. 4, 554–559 (2015).
Causier, B. et al. The TOPLESS interactome: A framework for gene repression in Arabidopsis. Plant Physiol. 158(1), 423–438 (2012).
Ciarbelli, A. R. et al. The arabidopsis homeodomain-leucine Zipper II gene family: Diversity and redundancy. Plant Mol. Biol. 68(4–5), 465–478 (2008).
Turchi, L. et al. Arabidopsis HD-Zip II transcription factors control apical embryo development and meristem function. Development (Cambridge, England) 140(10), 2118–2129 (2013).
Bou-Torrent, J. et al. ATHB4 and HAT3, two class II HD-ZIP transcription factors, control leaf development in Arabidopsis. Plant Signal. Behav. 7(11), 1382–1387 (2012).
Staswick, P. E., Su, W. & Howell, S. H. Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proc. Natl. Acad. Sci. 2, 2 (1992).
Yoshihara, A. et al. Structure of a tuber-inducing stimulus from potato leaves (Solanum tuberosum L.) (Organic Chemistry). Agric. Biol. Chem. 2, 2 (1989).
McConn, M. The critical requirement for linolenic acid is pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8(3), 403–416 (1996).
Acknowledgements
This project was supported by the National Science and Technology Major Project (2018ZX08020003-001-001), the National Natural Science Foundation of China (Grant No. 31700595), and the Fundamental Research Funds for the Central Universities (2572019BA13), Heilongjiang Touyan Innovation Team Program.
Author information
Authors and Affiliations
Contributions
P.A. and L.Z. conceived and designed the study. P.A., Q.C., and C.W. performed the experiments. P.A. wrote the paper. H.Z., and L.Z. reviewed and edited the manuscript. All authors read and approved the manuscrip.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
An, P., Wang, C., Cao, Q. et al. Genetic transformation and growth index determination of the Larix olgensis LoHDZ2 transcription factor gene in tobacco. Sci Rep 11, 20746 (2021). https://doi.org/10.1038/s41598-021-99533-0
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-021-99533-0
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.